ID: 1069543275

View in Genome Browser
Species Human (GRCh38)
Location 10:69311615-69311637
Sequence ATTGTATCCTGGAGGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069543275_1069543282 26 Left 1069543275 10:69311615-69311637 CCCTTCCTCCTCCAGGATACAAT 0: 1
1: 0
2: 2
3: 26
4: 300
Right 1069543282 10:69311664-69311686 TCTTCCTCTGTTGCCCAGGCTGG 0: 313
1: 25248
2: 101075
3: 197489
4: 230339
1069543275_1069543280 1 Left 1069543275 10:69311615-69311637 CCCTTCCTCCTCCAGGATACAAT 0: 1
1: 0
2: 2
3: 26
4: 300
Right 1069543280 10:69311639-69311661 CTTTCTTTTTTTTTCTGAGACGG 0: 9
1: 797
2: 12335
3: 104517
4: 82027
1069543275_1069543281 22 Left 1069543275 10:69311615-69311637 CCCTTCCTCCTCCAGGATACAAT 0: 1
1: 0
2: 2
3: 26
4: 300
Right 1069543281 10:69311660-69311682 GGAGTCTTCCTCTGTTGCCCAGG 0: 99
1: 10171
2: 49310
3: 123823
4: 173881

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069543275 Original CRISPR ATTGTATCCTGGAGGAGGAA GGG (reversed) Intronic
901377900 1:8852910-8852932 AGTGAATCCTGCAGGAAGAAAGG - Intergenic
901806011 1:11738988-11739010 AGTCTAACCTGGAGAAGGAAAGG - Intronic
902407815 1:16195515-16195537 ATTGGATCCTGGAACAGAAAAGG + Intergenic
904562350 1:31407169-31407191 GCTGTTTCCTGGAGGAGGATGGG - Intergenic
905463356 1:38135396-38135418 ATGGGATGCTGGAGGAAGAAGGG - Intergenic
907088356 1:51700412-51700434 ATTGAATCCTGGAACAGAAAAGG - Intronic
907295758 1:53452353-53452375 ATAGTATCAAGGAGGAAGAAGGG - Intergenic
907306085 1:53513866-53513888 GCTGTAGCCAGGAGGAGGAAGGG + Intronic
909932203 1:81509261-81509283 ATTGTCTCCAGGAGAAGCAAAGG - Intronic
910644636 1:89500318-89500340 CTTTTACCCTGGAGGTGGAATGG + Intergenic
911683863 1:100750258-100750280 ATGGCACCCGGGAGGAGGAAAGG + Intergenic
912414413 1:109498340-109498362 TTTATATTCTGCAGGAGGAAGGG + Intronic
912547091 1:110458570-110458592 ATGGAATCCTGGACGTGGAAGGG - Intergenic
914355838 1:146883814-146883836 AGTGTTTGCAGGAGGAGGAACGG - Intergenic
915611555 1:156997469-156997491 AGAGTGGCCTGGAGGAGGAAAGG + Intronic
915615380 1:157033840-157033862 AAGGTTTCCTGGTGGAGGAAAGG - Intronic
915708344 1:157868951-157868973 ATTCTCTCCTGGATCAGGAAGGG + Intronic
916328093 1:163585873-163585895 CTTTTAACCTGGAGAAGGAAAGG - Intergenic
918071921 1:181139560-181139582 ATTGTGTCCTGTCAGAGGAAGGG + Intergenic
918129333 1:181611551-181611573 ATCTTATCCTTGAGGAAGAATGG - Intronic
918703086 1:187630088-187630110 ATTGTAGCCTGCAGGCAGAAAGG + Intergenic
918851363 1:189694531-189694553 TTGGTTTCCTGGAGCAGGAAGGG - Intergenic
919119504 1:193321646-193321668 ATTTTATCTAGTAGGAGGAAAGG - Intergenic
920422380 1:205843910-205843932 ATTTTATACTGGAGGAAGAATGG + Intronic
920828390 1:209443792-209443814 ATTGTATCCTCAAGGAGGGTAGG - Intergenic
920936528 1:210440260-210440282 ATTAATTCCTGTAGGAGGAAAGG + Intronic
921524013 1:216194835-216194857 AGTGTATCCCAGAGGCGGAAAGG + Intronic
921760217 1:218904693-218904715 ATTCAAATCTGGAGGAGGAAGGG - Intergenic
922697807 1:227740386-227740408 ATTGACTGCTGGAGGGGGAATGG + Intronic
924005105 1:239600447-239600469 CTAATATCCTGGAAGAGGAATGG + Intronic
1064540107 10:16396576-16396598 GTTGTATTCTAGAGGAGAAAAGG - Intergenic
1065168667 10:23006379-23006401 AATGTATCTTGGATGAGAAAGGG + Intronic
1065280257 10:24130093-24130115 CTTGTACACTGAAGGAGGAAAGG - Intronic
1066271775 10:33831037-33831059 GTTGTGCCCTGGAGCAGGAAAGG - Intergenic
1067274373 10:44820986-44821008 GTTGGATCCTGGATCAGGAAAGG + Intergenic
1067564321 10:47325878-47325900 ATGCCAGCCTGGAGGAGGAAAGG + Exonic
1068617599 10:59136903-59136925 ATTGTATCCTGGAAGGGCCAAGG + Intergenic
1069543275 10:69311615-69311637 ATTGTATCCTGGAGGAGGAAGGG - Intronic
1070666942 10:78351623-78351645 TGTGTATCTTGGAGGAGGAAAGG + Intergenic
1071082215 10:81825910-81825932 ATTATATGCTGGACAAGGAATGG + Intergenic
1071930825 10:90467654-90467676 ATGGGATCCTGGAATAGGAAGGG - Intergenic
1072231468 10:93417553-93417575 ATGGGAGCCTGGAGGAAGAAGGG - Intronic
1072430055 10:95363103-95363125 ATTGTTTTGTGGAGGAAGAAAGG - Intronic
1072674713 10:97457174-97457196 GCTGTATCCTGGAGGAGGTCCGG - Exonic
1072868029 10:99085215-99085237 ATTGAATCATGGAAAAGGAAGGG + Intronic
1073628398 10:105122770-105122792 AAGATATCCTGGAGGAGGCAAGG + Intronic
1075547801 10:123368558-123368580 ATTGCATTCTAGAGGTGGAATGG - Intergenic
1075575565 10:123574891-123574913 ATTGGATCCTGGAACAGAAAAGG + Intergenic
1076232698 10:128835013-128835035 ATTTTACCCTGGAAGAGGAAGGG + Intergenic
1076828421 10:132982209-132982231 ATTGGCTCCTGGAGAAGGGAGGG + Intergenic
1077374358 11:2198583-2198605 ACAGGATCCTGGAGGGGGAAGGG - Intergenic
1078234457 11:9471350-9471372 AGAGTTTCCTGGAGGAGGGATGG + Exonic
1080304759 11:30824323-30824345 CTTGTGCCCTGGAGGAGGAGGGG - Intergenic
1083212429 11:61196320-61196342 AGTGTGTCCTTGAGCAGGAAGGG - Intergenic
1086286898 11:85261559-85261581 ATTGGATCTTGCGGGAGGAAGGG + Intronic
1086291962 11:85321697-85321719 AATGTATCAAGGAGGAGGAAAGG + Intronic
1088544578 11:110946707-110946729 ATTTTGTCCTGGAGTGGGAAGGG - Intergenic
1089468203 11:118699594-118699616 ATTGTCCCCTGCAGGAGGAAAGG + Intergenic
1089597577 11:119590846-119590868 ATCTTTTCCTGGAGGTGGAAGGG + Intergenic
1090955394 11:131509171-131509193 AGTGTGACCTTGAGGAGGAAAGG - Intronic
1091339006 11:134795781-134795803 ATTATCTTCTGGAGGAGGAGAGG + Intergenic
1091354432 11:134924729-134924751 ATGAGATGCTGGAGGAGGAAAGG - Intergenic
1091891433 12:4057959-4057981 ATTGGATCCTGGAACAGAAAAGG - Intergenic
1092552432 12:9517749-9517771 CTTGCATCCTGGAGGAGAAATGG + Intergenic
1093318676 12:17684585-17684607 ATAATATTCTGGAGGAGAAAAGG - Intergenic
1094222443 12:28008884-28008906 ATGTGATCCTGGAGGAAGAAGGG + Intergenic
1094255186 12:28416010-28416032 AATTTATCATGAAGGAGGAATGG + Intronic
1094519689 12:31172862-31172884 CTTGCATCCTGGAGGAGAAATGG - Intergenic
1094724215 12:33096043-33096065 AATGTGTCTTGGAGGAAGAAGGG + Intergenic
1096048605 12:48586515-48586537 AGTGTCTCCTGGAGGGGGATGGG - Intergenic
1096256412 12:50064673-50064695 AGTGTGTCCTGGAGGCAGAAGGG + Intronic
1099231570 12:80031816-80031838 ACTGGATCCTGGAGGAGGACAGG + Intergenic
1099237472 12:80098817-80098839 ATAGTATACTAGAGGAAGAAAGG - Intergenic
1101725668 12:107386184-107386206 ATTGAGGCCTGAAGGAGGAATGG - Intronic
1101853260 12:108421370-108421392 ATTACATCCTGGAGGAAAAATGG - Intergenic
1102180278 12:110907379-110907401 ATTATATCCTGAAGGAGAATCGG + Exonic
1102759812 12:115375412-115375434 TTTGGTTCCTGTAGGAGGAAGGG - Intergenic
1102786505 12:115609342-115609364 ATTGGATTCTGGAGCTGGAAAGG + Intergenic
1103344790 12:120242007-120242029 TTTGTTTCCTGCAGGAGGGATGG + Intronic
1103734870 12:123054234-123054256 ATTGTACCCAGGAGGTAGAAAGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1104228467 12:126860291-126860313 ATTCTATCAGGGAGGAAGAACGG + Intergenic
1104484264 12:129136288-129136310 ATTGGATCCTGGAACAGTAACGG - Intronic
1107060453 13:36154643-36154665 ATTGTCTCCTTGATCAGGAAAGG + Intergenic
1107215427 13:37912022-37912044 CTTGTATCCTTGAGGAATAAAGG + Intergenic
1107246034 13:38295211-38295233 ATTGGATCATGTAGGAGAAATGG + Intergenic
1107362887 13:39639033-39639055 ATTATATCCTGGATCTGGAAAGG - Intergenic
1109976372 13:69838988-69839010 TTTGTATGCTGTAGGAGGAATGG - Exonic
1110033200 13:70644283-70644305 AATGTCTCCTGGAGGAGGCGGGG + Intergenic
1110399761 13:75076361-75076383 ATGGTATCGGGGAAGAGGAAAGG - Intergenic
1111001207 13:82185621-82185643 ATTGTCTCCTGCAGGAGCAAAGG + Intergenic
1111848162 13:93538020-93538042 ATGGTATCTTGCAGGATGAAAGG + Intronic
1113265741 13:108616084-108616106 ATAGTTTCCTGGAGGAAGGAGGG - Intronic
1113797008 13:113064289-113064311 ATTATGACCTGGAGGAGAAAGGG - Exonic
1115233620 14:31187274-31187296 CTTGAACCCTGGAGGTGGAAGGG + Intronic
1116718448 14:48459667-48459689 ATTGGATCCTGGAAGAGAAAAGG - Intergenic
1118467509 14:66044270-66044292 AGTGTATCCAGGAGGAGAAAAGG + Intergenic
1118630321 14:67696410-67696432 AAGGAATCCTCGAGGAGGAAGGG - Intergenic
1120135381 14:80861694-80861716 ATTTTATCCTGGATCAGGAAAGG + Intronic
1121054000 14:90838249-90838271 TTTCCATCCTGGAGGAAGAAAGG - Intergenic
1121157649 14:91701629-91701651 AGAATATCCTAGAGGAGGAAAGG + Intronic
1122187311 14:100010068-100010090 ATTGTCTCCTGGATCTGGAAAGG + Intronic
1123564123 15:21524941-21524963 ATGGTATCATGGTGGAAGAATGG + Intergenic
1123600377 15:21962225-21962247 ATGGTATCATGGTGGAAGAATGG + Intergenic
1124359444 15:29024968-29024990 CTTGTCCCATGGAGGAGGAAGGG + Intronic
1125168309 15:36737213-36737235 ATTGGAACCTGCAGGAGCAAAGG - Intronic
1126274124 15:46856212-46856234 ATTTTATCCTGAAGGTGGTAAGG - Intergenic
1126545812 15:49872802-49872824 ATTGGATCCTAGAAGAGAAAAGG + Intronic
1127936158 15:63640763-63640785 ATTGGATCCTGGAGCAGAAAAGG - Intronic
1128370886 15:67038397-67038419 AGTCTATCCTGGGGAAGGAAAGG - Intergenic
1128708072 15:69851765-69851787 ATTCTTTCTGGGAGGAGGAAGGG + Intergenic
1132285983 15:100662881-100662903 AGTCCGTCCTGGAGGAGGAATGG + Intergenic
1132777662 16:1604712-1604734 ATGGGAACCTGGAGGAGGGAAGG + Intronic
1134399504 16:13896362-13896384 ATTGCATCAAGGAGGATGAAGGG + Intergenic
1134824213 16:17271713-17271735 AATGTCTCCTGGAGTAGGAGTGG + Intronic
1134830438 16:17318475-17318497 CTTCTACCCTGCAGGAGGAAAGG - Intronic
1135210292 16:20520195-20520217 AGTTTATCCTGGAGAAGGAAGGG + Intergenic
1137884460 16:52087646-52087668 ATTGTCTCCTGGATCTGGAAAGG - Intergenic
1138024115 16:53509496-53509518 ACTCTATCCTGGAGGACAAAGGG - Intergenic
1139129575 16:64125035-64125057 ATTAAATCCTGGAGAAGGTAGGG + Intergenic
1139978179 16:70831630-70831652 AGTGTTTGCAGGAGGAGGAACGG + Intronic
1141264254 16:82481819-82481841 ATAATATCTTGGAGGAAGAAGGG + Intergenic
1143046213 17:4081969-4081991 ATTGACTCTTGAAGGAGGAAGGG - Intronic
1144725750 17:17501515-17501537 ATTGTTTCCTTGGGGAGAAATGG - Intergenic
1145039213 17:19564515-19564537 ATTGTTACCTGGAGGAGGCAGGG + Intronic
1147390497 17:40106440-40106462 ACAGGATCCTGGAGGAGGCATGG + Intergenic
1149329307 17:55565093-55565115 ATTTTATTTTGGAGGAGGAGGGG + Intergenic
1149650219 17:58271885-58271907 ATTGTATCCTGCATGGGGGAGGG + Exonic
1150463790 17:65374645-65374667 TTGGTATCCAGGAGGAGGATTGG - Intergenic
1150813703 17:68376664-68376686 ATAGTATGCTGGAGGGGGAGTGG - Intronic
1151386733 17:73759620-73759642 ATGGTATCTTGGCGGGGGAAGGG + Intergenic
1151711082 17:75807084-75807106 AGTCTGTCCTGGAGAAGGAAAGG - Intronic
1153990169 18:10390021-10390043 ATTAACTTCTGGAGGAGGAACGG - Intergenic
1155729985 18:29144550-29144572 ATTGAATTCTGGAACAGGAATGG + Intergenic
1156479807 18:37429018-37429040 ATTGCATCGTAGAGGAGGCATGG + Intronic
1157051918 18:44176122-44176144 ATGGTACCCTGGAGGAGGAGTGG + Intergenic
1157477299 18:48031515-48031537 ATTGGATTTTTGAGGAGGAAGGG + Intronic
1159779313 18:72642867-72642889 TTTGTTTCCAGCAGGAGGAAGGG - Intergenic
1161229426 19:3165672-3165694 ATTGGATCCTGGTCCAGGAAAGG - Intergenic
1162535646 19:11261864-11261886 ACTGGACCCTGGAGGGGGAAGGG + Intronic
1162783259 19:13018306-13018328 TTTGTAGTCTGGAGGAGAAAAGG + Intronic
1163279942 19:16309696-16309718 ATTGGTGCCTGGAGCAGGAATGG - Intergenic
1164757152 19:30698478-30698500 ATGGTATCCTGGAGCAGAACAGG - Intronic
1164791753 19:30991722-30991744 ATTGTATCCTGGGAAAGAAAAGG - Intergenic
1167313736 19:48752339-48752361 CTTGGTTCCTGGAGGAGTAATGG + Intronic
1167446212 19:49539104-49539126 AGGGTTTCCTGGAGGAGAAAGGG - Exonic
1168257562 19:55175042-55175064 ATTGTACCCCTGAGGAGGCATGG - Intronic
925119829 2:1409654-1409676 ACTGGATCCTGGAAGAGGAAAGG - Intronic
925170308 2:1745963-1745985 ATAGGATCCTGCAGGAGAAATGG - Intergenic
925537514 2:4933384-4933406 AATCTCTCCTAGAGGAGGAAAGG - Intergenic
926129449 2:10292510-10292532 ACTTTATCCAGGACGAGGAAAGG - Intergenic
926337062 2:11871705-11871727 CTGGTATCCTGGAGCAGGTATGG - Intergenic
926440272 2:12881515-12881537 ATTATGTCCTGAAGGAGGACCGG + Intergenic
926603062 2:14867524-14867546 ATTGTAAGATGGAGGAGCAAGGG - Intergenic
926889632 2:17628161-17628183 ATTGTAGCCAGCAGGAGCAAAGG + Intronic
926891298 2:17641182-17641204 ACTTTATTCTGGAGGAGGTAGGG + Intronic
927076285 2:19581089-19581111 ATGGAATGCAGGAGGAGGAAGGG + Intergenic
927101593 2:19791667-19791689 ATTGGATCCTGGAACAGAAAAGG - Intergenic
927940982 2:27102584-27102606 AGTCTGGCCTGGAGGAGGAAGGG + Exonic
929760295 2:44801279-44801301 AATGCATTCTGGAGGAAGAAGGG + Intergenic
929967262 2:46544416-46544438 AGTGAATCTTGGAGGAGGAGGGG + Intronic
932140580 2:69273697-69273719 ATAGTATCCTTGAGGAGGGGTGG - Intergenic
933448313 2:82411702-82411724 ATGGTTTCCTGGAGGAATAACGG + Intergenic
935111265 2:100096354-100096376 ATTGTATTCTGGTGGAGATATGG - Intronic
936123705 2:109768810-109768832 ATTGTATTCTGGTGGAGATATGG + Intergenic
936220981 2:110602656-110602678 ATTGTATTCTGGTGGAGATATGG - Intergenic
938833024 2:135072215-135072237 ATTGGATCTTGTTGGAGGAAGGG + Intronic
941231603 2:162917331-162917353 ATTGGATCTTGCTGGAGGAAGGG - Intergenic
943914827 2:193617219-193617241 AATTTATTCTGGAGAAGGAAGGG + Intergenic
945599750 2:211845819-211845841 ATTGTACCTTGTAGGAGGAGAGG - Intronic
1168947281 20:1771829-1771851 ATTGTCTCATGAAGGAGGAGAGG - Intergenic
1169328330 20:4695739-4695761 TTTGTGACCTGGAGGAGGAATGG - Intronic
1170675826 20:18479755-18479777 ATGGAATCCTGGAGCAGAAAAGG + Intronic
1171006713 20:21473230-21473252 ATTGCATCCTTGAGGAAGGAGGG + Intergenic
1172566874 20:35937634-35937656 ATTTTCTCCTGGATCAGGAAAGG + Intronic
1174700077 20:52599396-52599418 ATTATCTCCTGGATGAGGCAGGG - Intergenic
1174821666 20:53731702-53731724 ATTTTATCGTAGAGCAGGAATGG + Intergenic
1174926174 20:54762608-54762630 ATTGAATCCTGGACCAAGAAAGG - Intergenic
1175640416 20:60624914-60624936 ACTGCATCCTGGAGCAGGAAAGG - Intergenic
1177502295 21:21972799-21972821 ATAGTACCATGGAGGAGGAGGGG - Intergenic
1177880429 21:26687961-26687983 ATTTTTGCCTGGAGGAGGGAGGG + Intergenic
1178248630 21:30978907-30978929 ATTAGATGCTGGAGAAGGAATGG + Intergenic
1179899624 21:44382650-44382672 TATGTGTCCTGGAGGAGGCAGGG + Intronic
1181455450 22:23057790-23057812 AATGTTTCCTGAAGGAGAAAAGG + Intergenic
1181781405 22:25196174-25196196 ATTGGCTCCTGCAGGGGGAAGGG + Exonic
1182621636 22:31621614-31621636 CCTGTTTCCTGCAGGAGGAAAGG + Intronic
1183160569 22:36110431-36110453 TTGGGACCCTGGAGGAGGAAGGG + Intergenic
1183348403 22:37320332-37320354 GCTTTATCCTGGAGAAGGAAAGG + Intergenic
1183616137 22:38946907-38946929 AAGGCTTCCTGGAGGAGGAATGG + Intergenic
1183816735 22:40308118-40308140 AGGGTATCTTGGGGGAGGAAAGG - Intronic
1184997429 22:48218951-48218973 ATTTTATCCTGGAGCAGGAATGG - Intergenic
1185045963 22:48528895-48528917 ATTGTAACCTGGAGAAGGGAGGG + Intronic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
950346520 3:12299241-12299263 ATTGTAAACTCAAGGAGGAATGG - Intronic
950351457 3:12357530-12357552 ATTGTAGAGTAGAGGAGGAAGGG - Intronic
950568959 3:13788208-13788230 ACTGAGGCCTGGAGGAGGAAAGG + Intergenic
951579957 3:24152315-24152337 ATTGCATTCTGGAAGAGGACTGG + Intronic
952710345 3:36425494-36425516 ATTGGATCCTGGACCAGAAAAGG + Intronic
954241629 3:49298357-49298379 AGTGTTTCCTGGAGCTGGAAGGG + Intronic
954664451 3:52244439-52244461 CTGGCTTCCTGGAGGAGGAAAGG + Intergenic
954847666 3:53574052-53574074 ACTGTGCTCTGGAGGAGGAAGGG + Intronic
954976406 3:54699278-54699300 ATGGGATGCTGGAGGAGCAAGGG + Intronic
957430635 3:80101173-80101195 ATTGTAGGCAGGAGGAAGAAGGG + Intergenic
958101047 3:89011290-89011312 ATTGTATACAGTAGGAGGTAAGG - Intergenic
958712204 3:97731033-97731055 ATTGTATCGTGGGGGATGATTGG + Intronic
960442461 3:117705937-117705959 ATGGTATCTTAGAGGAGGTAAGG + Intergenic
960956017 3:123031520-123031542 ATTTTATCCAGGAGGAGCTAAGG - Intergenic
961497379 3:127304509-127304531 ATTGTACCCAGGAGGGGGCAGGG - Intergenic
961558931 3:127715578-127715600 AATCTCTCCTGAAGGAGGAAAGG + Intronic
961654162 3:128432511-128432533 ACTGTTTCCTGGAGCGGGAAAGG + Intergenic
961939871 3:130625701-130625723 ATGGGATCCTGGAACAGGAAAGG + Intronic
964498420 3:157320876-157320898 ATGGCATCGTGGAGGAGGAGTGG - Intronic
964967922 3:162521250-162521272 TGTGTATTCTGCAGGAGGAAGGG - Intergenic
966322544 3:178716891-178716913 ATGATATCCTGGAGAAAGAAGGG - Intronic
968203589 3:196778685-196778707 ATTGGATCCTGGAACAGAAAAGG - Intronic
969593544 4:8135234-8135256 GTCGGATCCTGGAGGAGAAAAGG + Intronic
970994793 4:22253311-22253333 ATTTTTCTCTGGAGGAGGAAAGG + Intergenic
974642695 4:64652228-64652250 ATAGTATGCTGGAGGATGAGAGG - Intergenic
979246574 4:118513407-118513429 TTGGTATCCTGGGGGAGTAAGGG + Intergenic
980237595 4:130129637-130129659 ATAGTATCCTGGAAAAGAAAAGG + Intergenic
981701181 4:147608983-147609005 AATGCATCATGGAGAAGGAATGG - Intergenic
984349356 4:178570638-178570660 ATTGGATCTTGCTGGAGGAAGGG - Intergenic
984454746 4:179951239-179951261 AATGTATTCAGAAGGAGGAAAGG - Intergenic
989318628 5:40109824-40109846 ATTGAGTGCTGAAGGAGGAAGGG - Intergenic
990938240 5:61173358-61173380 ATTGTATCCTGGGGGAATGACGG + Intergenic
990977586 5:61573053-61573075 CCTGTTTCCTGGAGGTGGAAAGG - Intergenic
991400285 5:66244541-66244563 ATTTTACTCTGGAGCAGGAAGGG - Intergenic
992136181 5:73748743-73748765 ATGGAAACCTGGAGGTGGAAAGG - Intronic
992812858 5:80407518-80407540 ATTGCTGCCGGGAGGAGGAAGGG + Intergenic
993797984 5:92293705-92293727 ATTGTGTCCTTGAAGAGAAATGG + Intergenic
994057249 5:95431847-95431869 ATTGTGTTCTTGGGGAGGAAGGG - Intronic
994817740 5:104605891-104605913 AAAGAATCCTGGAGTAGGAAGGG + Intergenic
994825762 5:104711033-104711055 GGTGTATTCTGAAGGAGGAAAGG - Intergenic
995086074 5:108110937-108110959 AATGTATTAGGGAGGAGGAAAGG - Intronic
998721601 5:144957919-144957941 AATGTATACTGGAGGAGGCGGGG + Intergenic
999068676 5:148718849-148718871 TTTCTATTCTGAAGGAGGAAGGG - Intergenic
999179230 5:149657225-149657247 GGTGTTTACTGGAGGAGGAACGG - Intergenic
999785029 5:154883140-154883162 CTTGAATCCTGAGGGAGGAAAGG - Intergenic
1002105882 5:176879295-176879317 CTTGTGTCCTGGAGGTGGGAGGG - Exonic
1002175406 5:177398724-177398746 ATGGTATCTTGGAGGAAGGAAGG - Exonic
1002932086 6:1641755-1641777 ATTAAATCCTGAAGAAGGAAAGG - Intronic
1005460059 6:26059924-26059946 GATGTATACTGGAAGAGGAAGGG - Intergenic
1006120023 6:31798430-31798452 ATTGGTTCCTGGAGAAGGAGAGG - Intronic
1008027896 6:46658960-46658982 AGTGTATTCTGGAGGTCGAATGG + Exonic
1008520317 6:52356790-52356812 ATTTTATCCTGGGGGAGAGAGGG - Intergenic
1009758914 6:67978499-67978521 AGTGAAGTCTGGAGGAGGAAAGG - Intergenic
1009758919 6:67978528-67978550 AGTGAAATCTGGAGGAGGAAAGG - Intergenic
1010101367 6:72112150-72112172 ATTGGATGCAGGGGGAGGAAAGG - Intronic
1011305619 6:85923131-85923153 GATGTATGCTGGAGGATGAAAGG + Intergenic
1011747346 6:90419067-90419089 ATGGTATCCCAGAGGAGCAAAGG - Intergenic
1012140317 6:95618776-95618798 ATTGGATCCTGGAACAGTAAAGG + Intergenic
1012392336 6:98756668-98756690 CTGGCCTCCTGGAGGAGGAAAGG - Intergenic
1013083484 6:106833581-106833603 ATGGAATTGTGGAGGAGGAAAGG + Intergenic
1013151849 6:107453773-107453795 ATGGTAGCCTGGAGAAGAAAGGG + Intronic
1014479712 6:121920861-121920883 ATGGAATCCTGGGGTAGGAAAGG - Intergenic
1015105129 6:129527672-129527694 ATTGTAGGCAGGAGGCGGAATGG - Intergenic
1015581524 6:134730336-134730358 ATTCTGTCCTTGAGGAGGAGGGG + Intergenic
1018839002 6:167505835-167505857 ATGGCAACCTGGAGGATGAAGGG - Intergenic
1019038189 6:169079935-169079957 ATTGGATCCTGGGGCAGAAAAGG + Intergenic
1019288546 7:235869-235891 AATGTTTCCTGGAACAGGAATGG - Intronic
1019891628 7:3951746-3951768 AGTGTGACCTGGAAGAGGAATGG + Exonic
1020604393 7:10317919-10317941 ATTGGATCCTGGAAGAGAAAGGG + Intergenic
1020960416 7:14795637-14795659 ATTGGATCCTGGAGTGGGAGGGG + Intronic
1022418203 7:30196218-30196240 ATTGCATCTTGCTGGAGGAAGGG + Intergenic
1022981672 7:35610469-35610491 CCTGTTTCCTGGAGGAGGAAGGG - Intergenic
1024233698 7:47382055-47382077 TTTGTATCCTGTAGGAGGCTGGG - Intronic
1024740319 7:52346938-52346960 ATTGAATCCTGGAACAGAAAAGG - Intergenic
1025024433 7:55504755-55504777 ATTGTTTCCTGGAGAAGAGAAGG - Intronic
1025518363 7:61684749-61684771 ATTGTTTCCTGTAGTAGAAAAGG - Intergenic
1025542689 7:62113396-62113418 ATTGTTTCCTGTAGTAGAAAAGG - Intergenic
1026438883 7:70425406-70425428 TGTGTATCCTGGGGAAGGAAAGG - Intronic
1026598663 7:71754901-71754923 AACTTATCCTGGAGAAGGAAGGG - Intergenic
1026989734 7:74577607-74577629 ATTATATCATGGAGGAGAACAGG - Intronic
1027249470 7:76389990-76390012 AGGGCTTCCTGGAGGAGGAAGGG + Exonic
1029336376 7:99903418-99903440 ATTGTTTCTGGGAGGAGGAATGG - Intronic
1030758814 7:113324810-113324832 ATTGCAACCTGTTGGAGGAAAGG - Intergenic
1034027465 7:147721701-147721723 ATTGAATCCTGGAGGAAAACAGG + Intronic
1034224317 7:149471066-149471088 AGTGATTCCTGTAGGAGGAAGGG + Intergenic
1035710064 8:1706301-1706323 AGTGTGTCCTGGAGGAAGACAGG - Exonic
1037857163 8:22380154-22380176 TTGGTATCCTGGAGGCGGAGAGG + Intronic
1038238511 8:25785309-25785331 TTTGGATCCTGGAGGAGGAAGGG + Intergenic
1038585804 8:28788314-28788336 ATTGGATCCTGGAACAGAAAAGG - Intronic
1038993575 8:32896489-32896511 ATTGGATCCTGGAAGATGGAAGG + Intergenic
1041632571 8:60104441-60104463 ATAGTGTCCTGGAAGAGAAAGGG + Intergenic
1041898676 8:62956874-62956896 ATTTTATGCGGGAGGGGGAATGG + Intronic
1042239955 8:66653895-66653917 ATTTGTTCTTGGAGGAGGAAGGG - Intronic
1043092319 8:75921081-75921103 ATTGTATTCCAGAGAAGGAAAGG - Intergenic
1044428791 8:92084669-92084691 ATTCTATCTTTGGGGAGGAAGGG + Intronic
1045090211 8:98734144-98734166 ATTGGATCATGGAGGTGGATTGG - Intronic
1045294923 8:100864227-100864249 AGTGTATGCTGGACGATGAATGG - Intergenic
1045867148 8:106880741-106880763 ATTGAAGCAAGGAGGAGGAAAGG + Intergenic
1045999957 8:108408150-108408172 AGTATATCCTGTAGGAAGAAAGG - Intronic
1047171946 8:122502352-122502374 CTTGTATCCTGAAGGATGAATGG + Intergenic
1047207276 8:122812742-122812764 AGTAAATCCTGGAGGAGGGAAGG + Intronic
1047511924 8:125521939-125521961 AATATATTCTGGAAGAGGAAGGG - Intergenic
1048357398 8:133664742-133664764 AATGGACCATGGAGGAGGAAGGG - Intergenic
1048550880 8:135432824-135432846 AGGGTATCCTGGATGAGGCAGGG + Intergenic
1048794390 8:138136350-138136372 ATTGGATTCTGGAAGAGAAAGGG + Intronic
1051916294 9:22211900-22211922 TTTGTATCCTGAAGGGGGAGAGG + Intergenic
1054746566 9:68859653-68859675 GTGGTATCCTGGAGGAAGGAAGG + Intronic
1055906833 9:81304588-81304610 ATTTTGTCCTGGAGGCAGAAAGG + Intergenic
1056518708 9:87380312-87380334 ATTGAATTTTGGCGGAGGAAAGG - Intergenic
1056692723 9:88822101-88822123 AGTGTCTCTTGGTGGAGGAAGGG + Intergenic
1056839699 9:89988396-89988418 ATTATGTCCTTGAGGGGGAAGGG - Intergenic
1057671415 9:97092941-97092963 ATGGAATCCTGGAGCAGAAAAGG - Intergenic
1058553736 9:106143631-106143653 ATTGTAAGCTGTAGGAGGAGTGG + Intergenic
1058654314 9:107206052-107206074 AGTGTGTCGTGGAGGATGAACGG + Intergenic
1058918118 9:109587083-109587105 AGTGTATACTGGAGGAGAGAAGG + Intergenic
1059075469 9:111188684-111188706 ATAGTATCCTTGAGGAAGTAAGG - Intergenic
1059275796 9:113096076-113096098 AGTGTGTCCTGGAGGAGAATGGG - Intergenic
1059322502 9:113480619-113480641 ACGGTATCCTGAAGGAGGAATGG + Intronic
1059520558 9:114937548-114937570 ATTTTAAACTGGAAGAGGAAGGG - Intergenic
1061173808 9:128979247-128979269 ATTATATCCTGTTTGAGGAAGGG - Exonic
1185918457 X:4062734-4062756 AGATCATCCTGGAGGAGGAAGGG + Intergenic
1186591897 X:10939486-10939508 ATTGTGTAGTGGAGGATGAAAGG - Intergenic
1186737483 X:12481075-12481097 CTTGTTGCCTGGAGGAAGAAAGG + Intronic
1186881366 X:13869896-13869918 ATTGTATCCTGGAATGGAAAAGG - Intronic
1187399179 X:18944460-18944482 ATTACATTCTGGAGGAGGGAGGG + Intronic
1187957770 X:24536771-24536793 ATTATATGGTGGAGGAGGGAGGG - Intronic
1187970658 X:24654775-24654797 AATGTATCATGAAGAAGGAAGGG + Intronic
1188059152 X:25579055-25579077 ATTGCATCTTGAAGGAGGTAGGG + Intergenic
1188601820 X:31976050-31976072 ATTCTCTGCTGGAGGATGAATGG + Intronic
1190149354 X:47930687-47930709 ATTGGATCCTGGAACAGAAAAGG - Intronic
1195631588 X:107061146-107061168 ATTTGATCCTGGATCAGGAAAGG + Intergenic
1198242437 X:134798712-134798734 ATTGAATCTTGCTGGAGGAAGGG + Intronic
1198376716 X:136048165-136048187 ATTGTAACCAGAAGGATGAAGGG + Intergenic
1199886434 X:152025965-152025987 AGTGAAGGCTGGAGGAGGAATGG - Intergenic
1200538869 Y:4434004-4434026 ATTGTATACTAGAGAAGGCAGGG + Intergenic
1201670610 Y:16516161-16516183 ACTGTAGCCTGGCGGGGGAAGGG - Intergenic