ID: 1069544356

View in Genome Browser
Species Human (GRCh38)
Location 10:69318381-69318403
Sequence GGGGCGAGCCCTCATTTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069544344_1069544356 11 Left 1069544344 10:69318347-69318369 CCCCTCCGGCACCTCGGCGTCCA 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1069544356 10:69318381-69318403 GGGGCGAGCCCTCATTTCCGAGG No data
1069544346_1069544356 9 Left 1069544346 10:69318349-69318371 CCTCCGGCACCTCGGCGTCCACC 0: 1
1: 0
2: 0
3: 12
4: 198
Right 1069544356 10:69318381-69318403 GGGGCGAGCCCTCATTTCCGAGG No data
1069544349_1069544356 0 Left 1069544349 10:69318358-69318380 CCTCGGCGTCCACCGGACTCCTA 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1069544356 10:69318381-69318403 GGGGCGAGCCCTCATTTCCGAGG No data
1069544345_1069544356 10 Left 1069544345 10:69318348-69318370 CCCTCCGGCACCTCGGCGTCCAC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1069544356 10:69318381-69318403 GGGGCGAGCCCTCATTTCCGAGG No data
1069544340_1069544356 26 Left 1069544340 10:69318332-69318354 CCCACTTCTGCAAGTCCCCTCCG 0: 1
1: 0
2: 2
3: 12
4: 126
Right 1069544356 10:69318381-69318403 GGGGCGAGCCCTCATTTCCGAGG No data
1069544341_1069544356 25 Left 1069544341 10:69318333-69318355 CCACTTCTGCAAGTCCCCTCCGG 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1069544356 10:69318381-69318403 GGGGCGAGCCCTCATTTCCGAGG No data
1069544353_1069544356 -9 Left 1069544353 10:69318367-69318389 CCACCGGACTCCTAGGGGCGAGC 0: 1
1: 0
2: 0
3: 0
4: 42
Right 1069544356 10:69318381-69318403 GGGGCGAGCCCTCATTTCCGAGG No data
1069544348_1069544356 6 Left 1069544348 10:69318352-69318374 CCGGCACCTCGGCGTCCACCGGA 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1069544356 10:69318381-69318403 GGGGCGAGCCCTCATTTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069544356 Original CRISPR GGGGCGAGCCCTCATTTCCG AGG Intronic
No off target data available for this crispr