ID: 1069544478

View in Genome Browser
Species Human (GRCh38)
Location 10:69318766-69318788
Sequence GGGGACGGGAGCGCGGAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069544461_1069544478 30 Left 1069544461 10:69318713-69318735 CCGCAACCAATGGGCGTGGAGGA 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1069544478 10:69318766-69318788 GGGGACGGGAGCGCGGAGACCGG No data
1069544464_1069544478 24 Left 1069544464 10:69318719-69318741 CCAATGGGCGTGGAGGAGGTGGG 0: 1
1: 0
2: 6
3: 17
4: 270
Right 1069544478 10:69318766-69318788 GGGGACGGGAGCGCGGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069544478 Original CRISPR GGGGACGGGAGCGCGGAGAC CGG Intronic
No off target data available for this crispr