ID: 1069546020

View in Genome Browser
Species Human (GRCh38)
Location 10:69329611-69329633
Sequence CCTGTCATTCATGAGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069546020_1069546024 -3 Left 1069546020 10:69329611-69329633 CCACACAACTCATGAATGACAGG 0: 1
1: 0
2: 1
3: 8
4: 162
Right 1069546024 10:69329631-69329653 AGGGATAGGAACACTACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069546020 Original CRISPR CCTGTCATTCATGAGTTGTG TGG (reversed) Intronic
902248278 1:15136335-15136357 CCTGTCATTTACCAGCTGTGTGG + Intergenic
902417172 1:16246995-16247017 CCTGGCATCCCTGAGTTGTATGG + Exonic
908814587 1:68018604-68018626 CATATCATTCATCACTTGTGTGG + Intergenic
909920633 1:81376707-81376729 TCTGTCATGCATGAGTTAAGTGG - Intronic
915635646 1:157184707-157184729 CCTGTCCCTCAAGGGTTGTGCGG + Intergenic
915643173 1:157245629-157245651 GGTGTCATACATGAGTTGAGAGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917506375 1:175630830-175630852 CCTGTTATTCATAAGCTGTCCGG - Intronic
919825704 1:201501685-201501707 CCTGACTTTCATGAGATTTGGGG - Intronic
924163221 1:241255351-241255373 CCTGTCAATGATGAGTTGGAAGG - Intronic
1069546020 10:69329611-69329633 CCTGTCATTCATGAGTTGTGTGG - Intronic
1069951661 10:72022966-72022988 CCTGTCATTCAGCAATTGAGTGG - Intergenic
1070355521 10:75636251-75636273 GCTGTCATTTAGGAGTGGTGTGG + Intronic
1073454906 10:103630546-103630568 CCTGCAATTCCTGAGTTTTGTGG - Intronic
1074699483 10:116080664-116080686 CCTGTTATTCATGAATTCTTTGG + Intronic
1076298696 10:129407220-129407242 CCTGTCATTCCTGAGAAATGTGG + Intergenic
1077447280 11:2602437-2602459 CTTGTAATTGCTGAGTTGTGTGG + Intronic
1078127058 11:8576756-8576778 TCTGTCATTTATTAGCTGTGTGG - Intronic
1079669219 11:23145397-23145419 CCTGTGATTCAAAAGTAGTGTGG - Intergenic
1079783912 11:24646017-24646039 TCTGCCTCTCATGAGTTGTGTGG + Intronic
1081520622 11:43877722-43877744 CCTGTCAATCAAGAGGTTTGGGG + Intergenic
1083983416 11:66192836-66192858 CCTGTCACTTTTGAGTTGCGGGG + Intronic
1084063314 11:66689493-66689515 CCTGGCCTCCATGGGTTGTGTGG - Intronic
1085853419 11:80148437-80148459 CCTGTCATTCAGGTGTTCAGAGG - Intergenic
1086500008 11:87443046-87443068 CATGTCATTCTTGCGTGGTGGGG - Intergenic
1088840032 11:113618667-113618689 CCTGTCATTTATGGGCTATGTGG - Intergenic
1090616192 11:128517543-128517565 CTTGTCATTCAAAAGTTGTTGGG - Intronic
1090649762 11:128796043-128796065 TCTGTCAGTTATGAGCTGTGTGG - Intronic
1091242517 11:134063437-134063459 TCTGTCCTTCATGGGGTGTGTGG + Intergenic
1092901501 12:13064063-13064085 CCCATCAGTCATGAGTTTTGAGG + Intronic
1092990912 12:13898393-13898415 TCTGCCATTTATTAGTTGTGTGG - Intronic
1093886284 12:24465203-24465225 TATGTCATTTATTAGTTGTGTGG - Intergenic
1095184149 12:39181367-39181389 CCTGTCAATCACTAGCTGTGTGG + Intergenic
1096085274 12:48861457-48861479 CCTGGCATTCTGGACTTGTGAGG - Intronic
1097871839 12:64608904-64608926 CCTATCATTCAGTAGCTGTGTGG + Intergenic
1098846119 12:75538065-75538087 CCTGGCATTCCTGGGTGGTGGGG - Intergenic
1099635720 12:85208237-85208259 CTTGTCATTTCTGAGTTTTGAGG - Intronic
1100121981 12:91379152-91379174 CCTGGCATCCATGAGGTGAGAGG + Intergenic
1104082473 12:125442446-125442468 CCTGTCATTTACTAGCTGTGTGG + Intronic
1110244763 13:73310236-73310258 CCTGCCATTTACTAGTTGTGTGG + Intergenic
1111653812 13:91128170-91128192 CAAGTGATTCATGAGTGGTGTGG - Intergenic
1112223571 13:97515147-97515169 GATGTCATTCATGACTTGGGTGG + Intergenic
1112392863 13:99001309-99001331 CCTGTTATTAAGGAGTTCTGGGG - Intronic
1120317580 14:82915713-82915735 CCTGTGAATCAGGAGATGTGGGG + Intergenic
1121891569 14:97597277-97597299 CATGTCTTTTATCAGTTGTGGGG - Intergenic
1123937471 15:25200945-25200967 CCTGTCCTTCCAGAGTTCTGTGG + Intergenic
1124875465 15:33588261-33588283 TCTGTCATTAATTAGCTGTGTGG - Intronic
1126340710 15:47637885-47637907 CCTGTGATTTATGTGTTGTCTGG - Intronic
1130886048 15:88093523-88093545 ACTGCCATTTATGAGCTGTGTGG - Intronic
1131769758 15:95724465-95724487 CATGTCATTCATGATGTCTGGGG - Intergenic
1132204623 15:99977911-99977933 CCTGTAAATCAGGGGTTGTGTGG - Intronic
1134022718 16:10932443-10932465 TCTGCCATTTATGAGCTGTGTGG - Intronic
1134374923 16:13662912-13662934 TCTGTCATTTATCAGCTGTGTGG + Intergenic
1135955240 16:26951460-26951482 CCTGTCCTCTATGAGCTGTGAGG - Intergenic
1141458947 16:84165250-84165272 CTTTTTATTAATGAGTTGTGAGG + Intronic
1141503877 16:84462340-84462362 CCTGTCACTCAAGAGTAGTAGGG + Intronic
1142417359 16:89949717-89949739 CCTTTCATTGCTAAGTTGTGGGG + Intronic
1142577799 17:920978-921000 CCTGTCATCCAGGACTTTTGGGG - Intronic
1143066942 17:4257186-4257208 CCTGTCTTTCATACGTTCTGTGG + Intronic
1143268555 17:5658761-5658783 CCTGCCATTCAGCAGATGTGAGG - Intergenic
1147569468 17:41559642-41559664 TCTGTGAGTCATGAGTTGAGTGG - Intergenic
1150428871 17:65100267-65100289 CCTGTCGATCATGTGCTGTGAGG - Intergenic
1151250315 17:72829185-72829207 CATTTCATTCATTTGTTGTGTGG - Intronic
1153348552 18:4054024-4054046 CCTGACAATCATGAGGGGTGAGG + Intronic
1156136290 18:34042936-34042958 CCTGTCATTCACAACCTGTGTGG + Intronic
1156352635 18:36314174-36314196 CCTGTTATGGATGAATTGTGAGG + Intronic
1157103080 18:44747477-44747499 CCTGCCATTCTCGAGCTGTGTGG - Intronic
1163893786 19:20039606-20039628 CCTGTCACTCATGACCTGAGGGG - Intergenic
1164863959 19:31588414-31588436 CCTGACATTCCTGATTGGTGAGG + Intergenic
926576061 2:14583261-14583283 CCTGCCATTCACTAGCTGTGCGG + Intergenic
926580767 2:14631952-14631974 ACTCACATACATGAGTTGTGAGG + Intergenic
927021636 2:19022972-19022994 ACTTTCATTCATGAGATTTGGGG + Intergenic
932815619 2:74858922-74858944 CCTGTGCTTCATAGGTTGTGTGG + Intronic
936921012 2:117688073-117688095 CCTGGCAGTAATGAGTGGTGCGG + Intergenic
937571397 2:123367350-123367372 CCTGTCATTTATGGCTAGTGTGG - Intergenic
938723314 2:134085336-134085358 CCTTATATTAATGAGTTGTGTGG + Intergenic
939232471 2:139447606-139447628 ACTGGAATTCATGAGTTGAGGGG - Intergenic
940395260 2:153182604-153182626 CCTGTCAGTCAGGGGTTGTGGGG - Intergenic
942701919 2:178721029-178721051 CATGTCATTCATTAATTCTGTGG - Exonic
945901553 2:215543576-215543598 GCTGTCATTCATGGCTTTTGAGG + Intergenic
946405095 2:219488289-219488311 CCTTTCATCCAGGAGATGTGCGG - Exonic
946409724 2:219509977-219509999 CCTGACATGCATGGGGTGTGGGG + Intergenic
1169188729 20:3643232-3643254 CATGTCTTCCATGAGTTCTGGGG - Intronic
1171099068 20:22365353-22365375 CTTGTCATTCATGAGCTTGGTGG + Intergenic
1171205120 20:23273092-23273114 CATGTCCCTCATGAGGTGTGAGG - Intergenic
1172175657 20:32970540-32970562 CCTGCCATTGATTTGTTGTGTGG - Intergenic
1172885002 20:38224935-38224957 CCTGAGCTTCCTGAGTTGTGTGG + Intronic
1173096880 20:40041915-40041937 CCTGTGATTCATGGGGGGTGGGG - Intergenic
1173540848 20:43849817-43849839 CCTGTCATTCATGGGGTTAGGGG + Intergenic
1178284433 21:31313516-31313538 AATGTCATTCATGATATGTGGGG + Intronic
1179057302 21:37948014-37948036 CCTGTAACTCATGAGGAGTGAGG + Intergenic
1179270814 21:39849694-39849716 TCTTTCATTTCTGAGTTGTGGGG + Intergenic
1180693767 22:17739234-17739256 CCTGACAGTCACGAGTTGAGTGG + Intronic
1182116860 22:27761681-27761703 CCTGCCCATCATGAGTTGGGGGG - Intronic
1182163169 22:28144222-28144244 TCTGCCATTTATGAGCTGTGTGG - Intronic
1182233136 22:28854281-28854303 CCTGTAATCCAAGAGTTTTGGGG - Intergenic
1185345334 22:50308209-50308231 CCTGCCAGTCTTGAGATGTGTGG + Intergenic
949856409 3:8465712-8465734 TCTTTCATTCATGAGTTTTCTGG + Intergenic
950026209 3:9821559-9821581 CATGTCATTCATTAGTTCTTCGG - Intronic
952127585 3:30320002-30320024 GGTGTCAGTCATGAGGTGTGAGG - Intergenic
952629224 3:35444489-35444511 ACTGTCATACATGAGGTGGGTGG + Intergenic
953474957 3:43197315-43197337 CCTGTCATTCCTCTGTTTTGGGG + Intergenic
953703624 3:45215186-45215208 CCTGCCATGCATGAGCTGTTTGG - Intergenic
953952540 3:47202710-47202732 CCTGTCAATCATATGTAGTGAGG - Intergenic
955147652 3:56336180-56336202 CCTGACATTTATTAGCTGTGTGG + Intronic
956007634 3:64797719-64797741 CCTTTAATTGATGAATTGTGGGG + Intergenic
956229258 3:66995546-66995568 GCTATCATTCTTGTGTTGTGTGG + Intergenic
957315893 3:78575954-78575976 CCTGACATTCCTGGTTTGTGGGG + Intergenic
959473873 3:106785919-106785941 TCTGCCACTCATTAGTTGTGTGG - Intergenic
961481954 3:127186830-127186852 CCTTTCATTGTTGAGTTTTGAGG + Intergenic
962046571 3:131766149-131766171 CCTGCCACTCATTAGCTGTGTGG + Intronic
962702048 3:138009735-138009757 AAAGTCGTTCATGAGTTGTGAGG + Intronic
965223169 3:165953747-165953769 CCTTTCATTCAGGAGTTTTGAGG - Intergenic
965930935 3:174042791-174042813 TTTGTCACTTATGAGTTGTGTGG - Intronic
967139508 3:186542924-186542946 CTTGTCATTCAGGAGGTTTGGGG - Intronic
969712309 4:8851191-8851213 CCTGTCCTTCCTGTGTTGTAAGG - Intronic
970125729 4:12807827-12807849 TCTGTCATCCATGAGGGGTGTGG + Intergenic
971023759 4:22567236-22567258 TCTGTAATTCATGATTTTTGTGG - Intergenic
973118878 4:46492887-46492909 CCTGACATTCCTGGGTGGTGAGG + Intergenic
973645109 4:52942506-52942528 TCTGCCATTCATTAGTTGTGGGG + Intronic
974632729 4:64515025-64515047 TCTGTCATTTATTAATTGTGTGG + Intergenic
975808287 4:78136655-78136677 TCTGTCATTCATTAACTGTGTGG - Intronic
976455466 4:85241680-85241702 CTTGACATTTATGAGATGTGTGG + Intergenic
976889687 4:90031577-90031599 TCTGCCATTGATCAGTTGTGTGG + Intergenic
978209285 4:106116127-106116149 CCTTTCATTTAAGTGTTGTGTGG - Intronic
980298951 4:130963215-130963237 CCTATCATTCAGGAGTTGTGAGG + Intergenic
982314342 4:154016389-154016411 CCTGGCATTCAGGATTTATGTGG - Intergenic
985265233 4:188150753-188150775 CCTGCCACTGATGAGGTGTGTGG + Intergenic
985886566 5:2684772-2684794 CCCGGCACCCATGAGTTGTGGGG - Intergenic
986354863 5:6913833-6913855 CCTGTGATTCATCTGTTTTGTGG + Intergenic
987195413 5:15520854-15520876 CCTGTCCTCCAGGGGTTGTGTGG + Intronic
988663548 5:33300351-33300373 CCTGTCTTTCATTAGTGGTGAGG - Intergenic
988705938 5:33726040-33726062 CCTGGCACTAATGAGCTGTGTGG - Intronic
989506147 5:42229591-42229613 CCTGACATTCCTGATTAGTGGGG + Intergenic
989648186 5:43659329-43659351 CCTGTCATACATCATGTGTGTGG + Exonic
990960497 5:61388656-61388678 TCTGCCATTTATTAGTTGTGTGG - Intronic
993533582 5:89053002-89053024 CCTATCATTCATTAGTTCTAGGG + Intergenic
996566215 5:124881831-124881853 CATGTCATTGATTAGATGTGGGG - Intergenic
998581302 5:143378981-143379003 CCTGTGATTCATGGGTTGAGAGG - Intronic
999896723 5:156042333-156042355 TCTGTCATTTATTAGCTGTGTGG - Intronic
1002976708 6:2085898-2085920 CCTGTCATTCATTAATTCTGTGG + Intronic
1003367023 6:5484710-5484732 CCTGTGATTCCTGGGATGTGAGG - Intronic
1008932979 6:56958889-56958911 CCAGACATTAATGAGTTGAGGGG + Intronic
1012296203 6:97527766-97527788 CCCGTCACTCGTGAGTTATGAGG - Intergenic
1017635602 6:156440140-156440162 CCTGTAATTCTTGTGTTGAGGGG - Intergenic
1017703128 6:157095131-157095153 CTTGTGATTCAGTAGTTGTGGGG + Intronic
1017965443 6:159260663-159260685 CCTGTCAACCATAAGTTGCGTGG + Intronic
1018499574 6:164391850-164391872 CATGTCATTCATAAGTTGGCTGG - Intergenic
1018992386 6:168684207-168684229 CCTGTTATCAATGAGCTGTGAGG + Intergenic
1020145242 7:5637332-5637354 CCTGTCACTAAGGAGATGTGTGG - Intronic
1021111057 7:16695029-16695051 CCTCTCATTCATGTGTATTGAGG - Intronic
1022415181 7:30171404-30171426 ACTCTCATTCATGTGTTGAGTGG + Intergenic
1023202090 7:37709700-37709722 CATGTCTTTAATAAGTTGTGTGG - Intronic
1026575924 7:71571488-71571510 TCTGTCATTCATCAGCTGTAAGG - Intronic
1027160046 7:75795806-75795828 TCTGCCATCCATGAGTTTTGTGG - Intergenic
1029598751 7:101551400-101551422 CCTTTCATTCATGCGCTGTGTGG + Intronic
1033849962 7:145482898-145482920 CGTGTCATTCATAGGTTATGGGG + Intergenic
1036756294 8:11473396-11473418 CCTGTCATTCACCAGTGCTGGGG + Intronic
1038512750 8:28155523-28155545 CTTGTCATTCAGCAGCTGTGTGG + Intronic
1039435555 8:37557045-37557067 TCTGCCAATCATGAGCTGTGTGG + Intergenic
1048486351 8:134851261-134851283 CCTGCCATGAATGACTTGTGTGG + Intergenic
1051842568 9:21414762-21414784 CAGGTGATTCATGAGCTGTGGGG + Intronic
1055421432 9:76147563-76147585 CCAGTGATTCAGGAGTTTTGAGG - Intronic
1062423483 9:136495220-136495242 CATGTCAAACATGAGATGTGTGG - Exonic
1187047951 X:15666433-15666455 TCTGCCATTCATGACTTTTGAGG - Intergenic
1188822105 X:34788156-34788178 CTTGTCATTCATGTGTTCAGTGG + Intergenic
1189065697 X:37805984-37806006 CCAGACATTCATGAGTTCCGAGG - Intronic
1189513863 X:41691552-41691574 ACTGTCATTTAAGAGTTGTGTGG + Intronic
1195762605 X:108263062-108263084 TCTGTCATTCATGATGTTTGTGG - Intronic
1196067290 X:111478150-111478172 CCTGTCATTCATGTGTTTACTGG + Intergenic
1197281235 X:124538946-124538968 TCTGTCATGCATGAGTTAAGTGG + Intronic
1199693889 X:150329785-150329807 TCTGTCACGAATGAGTTGTGTGG + Intergenic