ID: 1069546728

View in Genome Browser
Species Human (GRCh38)
Location 10:69334494-69334516
Sequence ACTTTAAGGTACAGAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069546728_1069546743 18 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546743 10:69334535-69334557 GAGAAGGGCTGGGCCATTCGGGG No data
1069546728_1069546745 29 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546745 10:69334546-69334568 GGCCATTCGGGGAAGTCTCCGGG No data
1069546728_1069546734 -4 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546734 10:69334513-69334535 AAGTGAGAGGCCGCTGCCGGGGG No data
1069546728_1069546739 8 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546739 10:69334525-69334547 GCTGCCGGGGGAGAAGGGCTGGG No data
1069546728_1069546735 2 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546735 10:69334519-69334541 GAGGCCGCTGCCGGGGGAGAAGG No data
1069546728_1069546733 -5 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546733 10:69334512-69334534 AAAGTGAGAGGCCGCTGCCGGGG No data
1069546728_1069546738 7 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546738 10:69334524-69334546 CGCTGCCGGGGGAGAAGGGCTGG No data
1069546728_1069546742 17 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546742 10:69334534-69334556 GGAGAAGGGCTGGGCCATTCGGG No data
1069546728_1069546741 16 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546741 10:69334533-69334555 GGGAGAAGGGCTGGGCCATTCGG No data
1069546728_1069546744 28 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546744 10:69334545-69334567 GGGCCATTCGGGGAAGTCTCCGG No data
1069546728_1069546736 3 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546736 10:69334520-69334542 AGGCCGCTGCCGGGGGAGAAGGG No data
1069546728_1069546732 -6 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546732 10:69334511-69334533 TAAAGTGAGAGGCCGCTGCCGGG No data
1069546728_1069546731 -7 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT No data
Right 1069546731 10:69334510-69334532 TTAAAGTGAGAGGCCGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069546728 Original CRISPR ACTTTAAGGTACAGAGTTCC AGG (reversed) Intronic