ID: 1069546730

View in Genome Browser
Species Human (GRCh38)
Location 10:69334508-69334530
Sequence GGCAGCGGCCTCTCACTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069546730_1069546741 2 Left 1069546730 10:69334508-69334530 CCTTAAAGTGAGAGGCCGCTGCC No data
Right 1069546741 10:69334533-69334555 GGGAGAAGGGCTGGGCCATTCGG No data
1069546730_1069546738 -7 Left 1069546730 10:69334508-69334530 CCTTAAAGTGAGAGGCCGCTGCC No data
Right 1069546738 10:69334524-69334546 CGCTGCCGGGGGAGAAGGGCTGG No data
1069546730_1069546742 3 Left 1069546730 10:69334508-69334530 CCTTAAAGTGAGAGGCCGCTGCC No data
Right 1069546742 10:69334534-69334556 GGAGAAGGGCTGGGCCATTCGGG No data
1069546730_1069546745 15 Left 1069546730 10:69334508-69334530 CCTTAAAGTGAGAGGCCGCTGCC No data
Right 1069546745 10:69334546-69334568 GGCCATTCGGGGAAGTCTCCGGG No data
1069546730_1069546743 4 Left 1069546730 10:69334508-69334530 CCTTAAAGTGAGAGGCCGCTGCC No data
Right 1069546743 10:69334535-69334557 GAGAAGGGCTGGGCCATTCGGGG No data
1069546730_1069546739 -6 Left 1069546730 10:69334508-69334530 CCTTAAAGTGAGAGGCCGCTGCC No data
Right 1069546739 10:69334525-69334547 GCTGCCGGGGGAGAAGGGCTGGG No data
1069546730_1069546744 14 Left 1069546730 10:69334508-69334530 CCTTAAAGTGAGAGGCCGCTGCC No data
Right 1069546744 10:69334545-69334567 GGGCCATTCGGGGAAGTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069546730 Original CRISPR GGCAGCGGCCTCTCACTTTA AGG (reversed) Intronic