ID: 1069546738

View in Genome Browser
Species Human (GRCh38)
Location 10:69334524-69334546
Sequence CGCTGCCGGGGGAGAAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069546730_1069546738 -7 Left 1069546730 10:69334508-69334530 CCTTAAAGTGAGAGGCCGCTGCC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1069546738 10:69334524-69334546 CGCTGCCGGGGGAGAAGGGCTGG No data
1069546728_1069546738 7 Left 1069546728 10:69334494-69334516 CCTGGAACTCTGTACCTTAAAGT 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1069546738 10:69334524-69334546 CGCTGCCGGGGGAGAAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069546738 Original CRISPR CGCTGCCGGGGGAGAAGGGC TGG Intronic
No off target data available for this crispr