ID: 1069547275

View in Genome Browser
Species Human (GRCh38)
Location 10:69337823-69337845
Sequence TGTGCACCCTTCCACGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069547266_1069547275 22 Left 1069547266 10:69337778-69337800 CCTCACGGGAGGGTGGATGAGAG 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1069547275 10:69337823-69337845 TGTGCACCCTTCCACGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069547275 Original CRISPR TGTGCACCCTTCCACGGGGT GGG Intronic
No off target data available for this crispr