ID: 1069547800

View in Genome Browser
Species Human (GRCh38)
Location 10:69341235-69341257
Sequence CTGGGGAAGCAGAGGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2752
Summary {0: 2, 1: 9, 2: 71, 3: 651, 4: 2019}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069547800_1069547817 27 Left 1069547800 10:69341235-69341257 CCCTGCAACCTCTGCTTCCCCAG 0: 2
1: 9
2: 71
3: 651
4: 2019
Right 1069547817 10:69341285-69341307 CCGAGTAGCTGGGACTACAGGGG 0: 522
1: 1799
2: 3008
3: 2583
4: 1830
1069547800_1069547815 26 Left 1069547800 10:69341235-69341257 CCCTGCAACCTCTGCTTCCCCAG 0: 2
1: 9
2: 71
3: 651
4: 2019
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084
1069547800_1069547813 25 Left 1069547800 10:69341235-69341257 CCCTGCAACCTCTGCTTCCCCAG 0: 2
1: 9
2: 71
3: 651
4: 2019
Right 1069547813 10:69341283-69341305 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
1069547800_1069547810 16 Left 1069547800 10:69341235-69341257 CCCTGCAACCTCTGCTTCCCCAG 0: 2
1: 9
2: 71
3: 651
4: 2019
Right 1069547810 10:69341274-69341296 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204
1069547800_1069547812 17 Left 1069547800 10:69341235-69341257 CCCTGCAACCTCTGCTTCCCCAG 0: 2
1: 9
2: 71
3: 651
4: 2019
Right 1069547812 10:69341275-69341297 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069547800 Original CRISPR CTGGGGAAGCAGAGGTTGCA GGG (reversed) Intronic
Too many off-targets to display for this crispr