ID: 1069547801

View in Genome Browser
Species Human (GRCh38)
Location 10:69341236-69341258
Sequence GCTGGGGAAGCAGAGGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069547801_1069547815 25 Left 1069547801 10:69341236-69341258 CCTGCAACCTCTGCTTCCCCAGC No data
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084
1069547801_1069547812 16 Left 1069547801 10:69341236-69341258 CCTGCAACCTCTGCTTCCCCAGC No data
Right 1069547812 10:69341275-69341297 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028
1069547801_1069547817 26 Left 1069547801 10:69341236-69341258 CCTGCAACCTCTGCTTCCCCAGC No data
Right 1069547817 10:69341285-69341307 CCGAGTAGCTGGGACTACAGGGG 0: 522
1: 1799
2: 3008
3: 2583
4: 1830
1069547801_1069547813 24 Left 1069547801 10:69341236-69341258 CCTGCAACCTCTGCTTCCCCAGC No data
Right 1069547813 10:69341283-69341305 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
1069547801_1069547810 15 Left 1069547801 10:69341236-69341258 CCTGCAACCTCTGCTTCCCCAGC No data
Right 1069547810 10:69341274-69341296 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069547801 Original CRISPR GCTGGGGAAGCAGAGGTTGC AGG (reversed) Intronic
No off target data available for this crispr