ID: 1069547804

View in Genome Browser
Species Human (GRCh38)
Location 10:69341252-69341274
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46947
Summary {0: 1, 1: 80, 2: 1235, 3: 7980, 4: 37651}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069547804_1069547813 8 Left 1069547804 10:69341252-69341274 CCCCAGCTCAGGCAATCCTCCCG 0: 1
1: 80
2: 1235
3: 7980
4: 37651
Right 1069547813 10:69341283-69341305 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
1069547804_1069547815 9 Left 1069547804 10:69341252-69341274 CCCCAGCTCAGGCAATCCTCCCG 0: 1
1: 80
2: 1235
3: 7980
4: 37651
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084
1069547804_1069547817 10 Left 1069547804 10:69341252-69341274 CCCCAGCTCAGGCAATCCTCCCG 0: 1
1: 80
2: 1235
3: 7980
4: 37651
Right 1069547817 10:69341285-69341307 CCGAGTAGCTGGGACTACAGGGG 0: 522
1: 1799
2: 3008
3: 2583
4: 1830
1069547804_1069547810 -1 Left 1069547804 10:69341252-69341274 CCCCAGCTCAGGCAATCCTCCCG 0: 1
1: 80
2: 1235
3: 7980
4: 37651
Right 1069547810 10:69341274-69341296 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204
1069547804_1069547818 27 Left 1069547804 10:69341252-69341274 CCCCAGCTCAGGCAATCCTCCCG 0: 1
1: 80
2: 1235
3: 7980
4: 37651
Right 1069547818 10:69341302-69341324 CAGGGGCGTATCACCACGCCTGG No data
1069547804_1069547812 0 Left 1069547804 10:69341252-69341274 CCCCAGCTCAGGCAATCCTCCCG 0: 1
1: 80
2: 1235
3: 7980
4: 37651
Right 1069547812 10:69341275-69341297 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069547804 Original CRISPR CGGGAGGATTGCCTGAGCTG GGG (reversed) Intronic
Too many off-targets to display for this crispr