ID: 1069547806

View in Genome Browser
Species Human (GRCh38)
Location 10:69341254-69341276
Sequence GGCGGGAGGATTGCCTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4062
Summary {0: 1, 1: 34, 2: 226, 3: 830, 4: 2971}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069547806_1069547818 25 Left 1069547806 10:69341254-69341276 CCAGCTCAGGCAATCCTCCCGCC 0: 1
1: 34
2: 226
3: 830
4: 2971
Right 1069547818 10:69341302-69341324 CAGGGGCGTATCACCACGCCTGG No data
1069547806_1069547815 7 Left 1069547806 10:69341254-69341276 CCAGCTCAGGCAATCCTCCCGCC 0: 1
1: 34
2: 226
3: 830
4: 2971
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084
1069547806_1069547817 8 Left 1069547806 10:69341254-69341276 CCAGCTCAGGCAATCCTCCCGCC 0: 1
1: 34
2: 226
3: 830
4: 2971
Right 1069547817 10:69341285-69341307 CCGAGTAGCTGGGACTACAGGGG 0: 522
1: 1799
2: 3008
3: 2583
4: 1830
1069547806_1069547810 -3 Left 1069547806 10:69341254-69341276 CCAGCTCAGGCAATCCTCCCGCC 0: 1
1: 34
2: 226
3: 830
4: 2971
Right 1069547810 10:69341274-69341296 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204
1069547806_1069547812 -2 Left 1069547806 10:69341254-69341276 CCAGCTCAGGCAATCCTCCCGCC 0: 1
1: 34
2: 226
3: 830
4: 2971
Right 1069547812 10:69341275-69341297 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028
1069547806_1069547813 6 Left 1069547806 10:69341254-69341276 CCAGCTCAGGCAATCCTCCCGCC 0: 1
1: 34
2: 226
3: 830
4: 2971
Right 1069547813 10:69341283-69341305 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069547806 Original CRISPR GGCGGGAGGATTGCCTGAGC TGG (reversed) Intronic
Too many off-targets to display for this crispr