ID: 1069547807

View in Genome Browser
Species Human (GRCh38)
Location 10:69341268-69341290
Sequence ACTCGGGAGACTGAGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149322
Summary {0: 19, 1: 607, 2: 9095, 3: 46722, 4: 92879}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069547807_1069547815 -7 Left 1069547807 10:69341268-69341290 CCTCCCGCCTCAGTCTCCCGAGT 0: 19
1: 607
2: 9095
3: 46722
4: 92879
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084
1069547807_1069547818 11 Left 1069547807 10:69341268-69341290 CCTCCCGCCTCAGTCTCCCGAGT 0: 19
1: 607
2: 9095
3: 46722
4: 92879
Right 1069547818 10:69341302-69341324 CAGGGGCGTATCACCACGCCTGG No data
1069547807_1069547813 -8 Left 1069547807 10:69341268-69341290 CCTCCCGCCTCAGTCTCCCGAGT 0: 19
1: 607
2: 9095
3: 46722
4: 92879
Right 1069547813 10:69341283-69341305 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
1069547807_1069547817 -6 Left 1069547807 10:69341268-69341290 CCTCCCGCCTCAGTCTCCCGAGT 0: 19
1: 607
2: 9095
3: 46722
4: 92879
Right 1069547817 10:69341285-69341307 CCGAGTAGCTGGGACTACAGGGG 0: 522
1: 1799
2: 3008
3: 2583
4: 1830

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069547807 Original CRISPR ACTCGGGAGACTGAGGCGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr