ID: 1069547812

View in Genome Browser
Species Human (GRCh38)
Location 10:69341275-69341297
Sequence CCTCAGTCTCCCGAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 754157
Summary {0: 3228, 1: 113305, 2: 296144, 3: 221452, 4: 120028}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069547804_1069547812 0 Left 1069547804 10:69341252-69341274 CCCCAGCTCAGGCAATCCTCCCG 0: 1
1: 80
2: 1235
3: 7980
4: 37651
Right 1069547812 10:69341275-69341297 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028
1069547801_1069547812 16 Left 1069547801 10:69341236-69341258 CCTGCAACCTCTGCTTCCCCAGC No data
Right 1069547812 10:69341275-69341297 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028
1069547806_1069547812 -2 Left 1069547806 10:69341254-69341276 CCAGCTCAGGCAATCCTCCCGCC 0: 1
1: 34
2: 226
3: 830
4: 2971
Right 1069547812 10:69341275-69341297 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028
1069547805_1069547812 -1 Left 1069547805 10:69341253-69341275 CCCAGCTCAGGCAATCCTCCCGC 0: 2
1: 70
2: 908
3: 6456
4: 25911
Right 1069547812 10:69341275-69341297 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028
1069547800_1069547812 17 Left 1069547800 10:69341235-69341257 CCCTGCAACCTCTGCTTCCCCAG 0: 2
1: 9
2: 71
3: 651
4: 2019
Right 1069547812 10:69341275-69341297 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028
1069547803_1069547812 9 Left 1069547803 10:69341243-69341265 CCTCTGCTTCCCCAGCTCAGGCA 0: 1
1: 2
2: 54
3: 651
4: 5782
Right 1069547812 10:69341275-69341297 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069547812 Original CRISPR CCTCAGTCTCCCGAGTAGCT GGG Intronic
Too many off-targets to display for this crispr