ID: 1069547815

View in Genome Browser
Species Human (GRCh38)
Location 10:69341284-69341306
Sequence CCCGAGTAGCTGGGACTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14842
Summary {0: 660, 1: 2676, 2: 4545, 3: 3877, 4: 3084}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069547807_1069547815 -7 Left 1069547807 10:69341268-69341290 CCTCCCGCCTCAGTCTCCCGAGT 0: 19
1: 607
2: 9095
3: 46722
4: 92879
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084
1069547801_1069547815 25 Left 1069547801 10:69341236-69341258 CCTGCAACCTCTGCTTCCCCAGC No data
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084
1069547800_1069547815 26 Left 1069547800 10:69341235-69341257 CCCTGCAACCTCTGCTTCCCCAG 0: 2
1: 9
2: 71
3: 651
4: 2019
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084
1069547804_1069547815 9 Left 1069547804 10:69341252-69341274 CCCCAGCTCAGGCAATCCTCCCG 0: 1
1: 80
2: 1235
3: 7980
4: 37651
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084
1069547803_1069547815 18 Left 1069547803 10:69341243-69341265 CCTCTGCTTCCCCAGCTCAGGCA 0: 1
1: 2
2: 54
3: 651
4: 5782
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084
1069547806_1069547815 7 Left 1069547806 10:69341254-69341276 CCAGCTCAGGCAATCCTCCCGCC 0: 1
1: 34
2: 226
3: 830
4: 2971
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084
1069547808_1069547815 -10 Left 1069547808 10:69341271-69341293 CCCGCCTCAGTCTCCCGAGTAGC 0: 2669
1: 98238
2: 245369
3: 197943
4: 125099
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084
1069547805_1069547815 8 Left 1069547805 10:69341253-69341275 CCCAGCTCAGGCAATCCTCCCGC 0: 2
1: 70
2: 908
3: 6456
4: 25911
Right 1069547815 10:69341284-69341306 CCCGAGTAGCTGGGACTACAGGG 0: 660
1: 2676
2: 4545
3: 3877
4: 3084

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069547815 Original CRISPR CCCGAGTAGCTGGGACTACA GGG Intronic
Too many off-targets to display for this crispr