ID: 1069548233

View in Genome Browser
Species Human (GRCh38)
Location 10:69344001-69344023
Sequence ACCCAGAGATTGAACCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069548227_1069548233 22 Left 1069548227 10:69343956-69343978 CCAACATTCGTAAGGTCCATTCC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1069548233 10:69344001-69344023 ACCCAGAGATTGAACCCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 144
1069548231_1069548233 1 Left 1069548231 10:69343977-69343999 CCTGATGGCTCTGGTAAGTCTGT 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1069548233 10:69344001-69344023 ACCCAGAGATTGAACCCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 144
1069548230_1069548233 6 Left 1069548230 10:69343972-69343994 CCATTCCTGATGGCTCTGGTAAG 0: 1
1: 0
2: 1
3: 29
4: 310
Right 1069548233 10:69344001-69344023 ACCCAGAGATTGAACCCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069548233 Original CRISPR ACCCAGAGATTGAACCCTGA GGG Intronic
900010857 1:106645-106667 ACACAGAGACTGAAGCTTGAAGG - Intergenic
900026959 1:283209-283231 ACACAGAGACTGAAGCTTGAAGG - Intergenic
900172405 1:1275411-1275433 ACCCTGAGATTGCCCTCTGAGGG + Intergenic
900621607 1:3590158-3590180 ACCCTGAGATGGAACCGTGGAGG - Intronic
903399694 1:23032725-23032747 AGCAATAGATTGGACCCTGATGG + Intronic
904352840 1:29920201-29920223 ACCCAAAGGTTGAATCCTCATGG + Intergenic
905017286 1:34786400-34786422 ACCCACTGACAGAACCCTGAAGG + Intronic
905713757 1:40130282-40130304 ACCCACAGATTTTACCCTGTAGG - Intergenic
905920984 1:41718528-41718550 TGACAGAGATTGAACCCTGCTGG + Intronic
906519847 1:46460522-46460544 CCACAGAGCTTCAACCCTGATGG - Intergenic
907862038 1:58362957-58362979 AGCCAGAAATTGAACCCTGCTGG - Intronic
908552807 1:65226576-65226598 AGCCTGAGAATGAATCCTGAGGG + Exonic
917176334 1:172239718-172239740 ACCCAGAGAATGAACTGAGAAGG - Intronic
918342922 1:183582067-183582089 ACCCAGAGCTGCAGCCCTGAAGG + Intronic
918374447 1:183895087-183895109 CCCCAGAAATTCAACCCTGATGG + Intronic
922023024 1:221723167-221723189 CCCCAGAGATTACAGCCTGAAGG + Intronic
922259303 1:223922652-223922674 ACACAGAGACTGAAGCTTGAAGG - Intergenic
923312284 1:232746767-232746789 ACCCAGAATTTGATCCCTGAAGG - Intergenic
923559561 1:235028230-235028252 ACCCAGAGATTCTGCCGTGATGG + Intergenic
924273196 1:242356431-242356453 ACACAGAGATTGAACATTAAAGG - Intronic
924340483 1:243025398-243025420 ACACAGAGACTGAAGCTTGAAGG - Intergenic
1066711525 10:38240218-38240240 ACACAGAGATTGAACATTAAAGG + Intergenic
1066726630 10:38402417-38402439 ACCCTGAGCTTGACCTCTGACGG - Intergenic
1069548233 10:69344001-69344023 ACCCAGAGATTGAACCCTGAGGG + Intronic
1069973929 10:72197961-72197983 ACCCAGAAATTCTACCCTTAGGG + Intronic
1075439884 10:122471587-122471609 TCCCAGAGTATGAAACCTGAGGG + Intronic
1076892022 10:133289590-133289612 TCCCGGAGATGGAAACCTGAGGG + Intronic
1081918428 11:46749623-46749645 AACCATAGACTGAACCCTGGGGG + Intronic
1084690475 11:70722386-70722408 ACCCAGAGATTGGTCACTGCAGG - Intronic
1085022922 11:73220265-73220287 ACCTAGAGATTTTATCCTGAAGG + Intronic
1085051413 11:73382091-73382113 AGCCAGAGTCTGAACCCTGGTGG + Intronic
1088686107 11:112285718-112285740 ACCCAGTGTCTGAACACTGAAGG - Intergenic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1090937128 11:131353376-131353398 ACCCAGAAGGTGATCCCTGAGGG - Intergenic
1091262062 11:134242517-134242539 ACCCAGAGAAAAAACCCTGAGGG + Intronic
1094567717 12:31615347-31615369 AGCCTGAGAATGAATCCTGAGGG - Intergenic
1098112550 12:67138717-67138739 GCACAGAGATTGAACTCTGGAGG + Intergenic
1098217730 12:68237870-68237892 ATGCAGAGAATGAACCCAGATGG + Intergenic
1102618519 12:114175432-114175454 ACACCAAGACTGAACCCTGAAGG + Intergenic
1103419444 12:120768670-120768692 ACCCAGAGATTACTCCCTGACGG + Intronic
1105728159 13:23186168-23186190 ACCCTGACATTCAACTCTGAAGG + Intronic
1111725022 13:91996285-91996307 AACCAGACCTTGAACCCTGTTGG - Intronic
1112817934 13:103295433-103295455 AGCCAGAGATTGAATCCTCAGGG - Intergenic
1115483517 14:33886222-33886244 ACCCACACTTTGATCCCTGAGGG - Intergenic
1120120524 14:80674409-80674431 TCACAGAGTTTGAACACTGAAGG - Intronic
1127779272 15:62297162-62297184 ACCCAGAGGTAGAATCCTAAGGG - Intergenic
1129962465 15:79699734-79699756 ACAGAGGGATTGAATCCTGAAGG - Intergenic
1132176104 15:99716602-99716624 ACCCAGAGAAAGAAGCCTGCAGG - Intronic
1132558372 16:582572-582594 ACCCAGAACTTGAGCCCTGTGGG - Intronic
1133049722 16:3110593-3110615 ACCTAGAAAGTGGACCCTGAAGG + Intergenic
1133454897 16:5933478-5933500 ACAAGGAGATTCAACCCTGACGG - Intergenic
1141983237 16:87562622-87562644 ACCCAGAGACTGAAACCTGGTGG + Intergenic
1142453489 16:90200271-90200293 ACACAGAGACTGAAGCTTGAAGG + Intergenic
1143684775 17:8504934-8504956 ACTCAGAGATGGCACCCGGATGG + Intronic
1143836369 17:9696100-9696122 ACCCATAAATGGAACCCAGAGGG - Intronic
1144859653 17:18292794-18292816 TCCCAGAGACTTAAACCTGACGG - Exonic
1145721599 17:27078240-27078262 ACCCAGAGAGTGAAAACAGATGG - Intergenic
1145933994 17:28704483-28704505 ACCCAGAGCCAGAAGCCTGAGGG + Intronic
1146251309 17:31346589-31346611 AGCCTGAGAATGAATCCTGAGGG + Intronic
1147293043 17:39459221-39459243 AGGCAGAGGTTGAACCCTGGAGG - Intergenic
1151576803 17:74956585-74956607 AGCCAGAGAGTGAACCAGGAGGG + Intronic
1154144685 18:11857325-11857347 AACCTGAGATTAAACCCTGCTGG - Intronic
1156358633 18:36364300-36364322 ACCCAGAGATGGAATCCTTGCGG - Intronic
1158062847 18:53366908-53366930 ACCCAGAGATGGAAGCCACAGGG + Intronic
1159297415 18:66512892-66512914 ATCCTGAAAATGAACCCTGAAGG - Intronic
1161247061 19:3258988-3259010 ACCCAGGGACAGCACCCTGAGGG + Intronic
1161249773 19:3274215-3274237 CCCCAGTTATTGCACCCTGAAGG - Intronic
1165178517 19:33947889-33947911 ACCCAGAGAATGAGCCTGGAGGG - Intergenic
925916191 2:8608170-8608192 ACCCAGATATTAAAGCCAGAAGG + Intergenic
928026985 2:27748462-27748484 ACCCATAGATTGAACCCATAAGG - Intergenic
932435461 2:71700504-71700526 AGCCAGTGAATGAACACTGATGG - Intergenic
934209396 2:89962497-89962519 TACCAGAAATTGAACCCTGCTGG + Intergenic
936345125 2:111669877-111669899 ACACGGAGAATGAACGCTGAGGG + Intergenic
936716244 2:115190637-115190659 TCCCTGAGGTTGAACCCTGTGGG - Intronic
938366948 2:130742431-130742453 GCCCAGAGCTTCACCCCTGAGGG - Intergenic
945180050 2:207082562-207082584 AACCTGAGATTGAAGCCTGCAGG - Intronic
946869311 2:224071633-224071655 ACCCAGACTCTCAACCCTGAGGG + Intergenic
948978623 2:241480446-241480468 CCCCAGAGAGTACACCCTGAGGG - Intronic
949084933 2:242144920-242144942 ACACAGAGACTGAAGCTTGAAGG + Intergenic
1169285803 20:4306144-4306166 ACCCATAGCTGGAGCCCTGAGGG + Intergenic
1172029574 20:31972393-31972415 ACAGAGAGATTGAACTCTGAGGG + Intronic
1174116054 20:48226991-48227013 ACCCAGACAGTGAACAGTGAAGG - Intergenic
1174136959 20:48386348-48386370 ACCCGGAGAATGACCCCTGAAGG - Intergenic
1175989224 20:62779209-62779231 ACACAGGGCTAGAACCCTGAGGG - Intergenic
1177013676 21:15758116-15758138 CCCCAGAGATTGATTCCAGAGGG - Intronic
1181803203 22:25360423-25360445 ATCCAGCGGTTGAAGCCTGATGG - Exonic
1182515545 22:30856829-30856851 ACCCAGAGAATGAAGCCTACTGG + Intronic
1184099721 22:42335795-42335817 CCCCAGAGCTGGCACCCTGAAGG - Intronic
950597729 3:13999365-13999387 CCCCTGAGATTGAGCCCTGCTGG + Intronic
954288810 3:49638185-49638207 ATCAAGAGGTTGAACCCAGAAGG - Intronic
955400674 3:58589034-58589056 AGCCAGAATTTGAACCCAGATGG + Intronic
955538651 3:59951483-59951505 ACCCAGACAAGGAACTCTGAAGG + Intronic
961505510 3:127368523-127368545 ACCCAGAGAAAGAACCCCTATGG + Intergenic
962952815 3:140235267-140235289 TCCCCATGATTGAACCCTGAAGG + Intronic
965778990 3:172263754-172263776 ACCCAGAGATTAAACTCTATAGG - Intronic
968434935 4:579522-579544 ACCCTGTGATTGCACCGTGAGGG - Intergenic
968438964 4:612004-612026 CCCCAGAGAGTTAACCCTGGAGG - Intergenic
975223234 4:71838561-71838583 ACTAAGACATTGAACCCTGTGGG + Intergenic
975714030 4:77188554-77188576 ACCTAGAGAGTGGGCCCTGAAGG + Intronic
979262367 4:118663163-118663185 ACACAGAGACTGAAGCTTGAAGG + Intergenic
980271206 4:130586299-130586321 ACCCAGAGATTACCCACTGAAGG + Intergenic
981267328 4:142802204-142802226 CCCCAGAGAGTGAATCATGATGG + Intronic
982216189 4:153084582-153084604 ACTCTGAGATTAAACCCTGAGGG - Intergenic
983164651 4:164460288-164460310 ACCCAATGTTTGTACCCTGATGG + Intergenic
983224454 4:165072950-165072972 ACCAAGAGAGTGAACGCTGATGG + Intergenic
984484924 4:180355799-180355821 ACCCAGTGCCTGATCCCTGAAGG - Intergenic
984808449 4:183772747-183772769 ACAGAGACATTGGACCCTGAGGG - Intergenic
990086842 5:51988987-51989009 ACCCAAAGTTTGAACCCAGAAGG + Intergenic
991132140 5:63134806-63134828 AACCAGAGAGTGAACTCTGTAGG + Intergenic
991133663 5:63156027-63156049 AGGCAGAGCTTGAACCCAGAAGG - Intergenic
993549892 5:89260373-89260395 AGGCAGAGATTGCTCCCTGAGGG + Intergenic
994385254 5:99123332-99123354 ACACAGAGCTTGAACTGTGAAGG + Intergenic
996097603 5:119415290-119415312 ACCCATAGAATGTACACTGATGG + Intergenic
999385996 5:151154885-151154907 TGCCTGAGATTGAAGCCTGAGGG + Intronic
1005582163 6:27245756-27245778 AATCAGAGATTCAACCCTGCTGG - Intergenic
1005585827 6:27275698-27275720 ACCCAGAAATTGGCACCTGAAGG + Intergenic
1007196194 6:40062799-40062821 AAGCAGAGATTGGACCCTGCAGG - Intergenic
1007782005 6:44259762-44259784 ACCCAGAGAGCCATCCCTGAGGG - Intronic
1008746733 6:54679794-54679816 TCCAAGAGATTAAATCCTGAGGG + Intergenic
1012913848 6:105147118-105147140 GCCCAGAGATTGAATCCTTCTGG - Intergenic
1014600576 6:123406981-123407003 ACCCTGAGCTTGGAGCCTGAAGG - Intronic
1014946956 6:127510318-127510340 ACCCAGAAATAGAGCCCTGAAGG + Intronic
1016189102 6:141238470-141238492 ACCCAGAAATTGTGCCATGAAGG + Intergenic
1016934772 6:149441448-149441470 TCCCAGGGTATGAACCCTGATGG + Intergenic
1018209767 6:161469594-161469616 AGAGAGAGATTGAAACCTGAAGG + Intronic
1025900205 7:65738195-65738217 TCCCAGCGCTTGAACCCGGAAGG - Intergenic
1027438217 7:78189662-78189684 ACCAAGGGACAGAACCCTGAGGG + Intronic
1030822566 7:114113027-114113049 CATCAGAGATTGAACCATGATGG + Intronic
1031499108 7:122490110-122490132 ACCCAGAAACTGAATCCTAAAGG - Exonic
1033470734 7:141646853-141646875 AGCCAGAGAGTGAACACTGTAGG - Intronic
1034312801 7:150104260-150104282 ACTATGAGATTGAACCTTGAAGG + Intergenic
1034794057 7:153996405-153996427 ACTATGAGATTGAACCTTGAAGG - Intronic
1037037244 8:14182245-14182267 GTCCACTGATTGAACCCTGAAGG + Intronic
1037521512 8:19684587-19684609 ACCCAGGGATTGCTCCCTGAAGG + Intronic
1037651055 8:20838799-20838821 ACACAGAGAACGAAACCTGATGG + Intergenic
1037762118 8:21748441-21748463 ACCTGGAGATAGAACCCTGGTGG - Intronic
1039922007 8:41899685-41899707 AACCAGAACTTGAATCCTGAGGG + Intergenic
1045404877 8:101855987-101856009 AGCCTGAGATTAAACCCTGAGGG - Intronic
1045957094 8:107921099-107921121 ACCTAGAGGTTAAACACTGAAGG + Intronic
1048543751 8:135367018-135367040 ACCCAGAGATGAAGCCCAGATGG - Intergenic
1049815618 8:144597968-144597990 TCCCAGAGGTGGAAACCTGAGGG + Intronic
1050174137 9:2852520-2852542 ACAGAGAGATTGTACCCTAAAGG - Intergenic
1051075170 9:13224824-13224846 ACCCTGAAGTTGAACCCTGGCGG - Intronic
1051706328 9:19884377-19884399 ACCCAGATATAGAACCAGGATGG - Intergenic
1052162612 9:25285071-25285093 ACACAGAGTTTGAAGCCAGATGG - Intergenic
1053150054 9:35737576-35737598 ACCCACAGACAGAAGCCTGAAGG + Intronic
1054907223 9:70421568-70421590 ACCCAGAGCTGGAACCCCCACGG - Intergenic
1055577181 9:77671758-77671780 AACCAGGGAATGAACCCTGGAGG + Intergenic
1059206542 9:112472472-112472494 ACCCAGAGATTGCTGCCTCACGG - Intronic
1203556954 Un_KI270744v1:7859-7881 ACCTAGATATTAAGCCCTGAAGG - Intergenic
1189915369 X:45851136-45851158 ACCGAGGGAGTGAACCCTAAGGG + Intergenic
1192450297 X:71240613-71240635 ACCCAGAGTCTGGACCCAGAAGG + Exonic
1192962101 X:76142276-76142298 AACCAGAGATTAAATCCTGTTGG + Intergenic
1192963432 X:76152811-76152833 AACCAGAGATTAAATCCTGTTGG - Intergenic
1193840683 X:86404802-86404824 ACGCAGGGATGGAACCCTCATGG - Intronic
1197171090 X:123435177-123435199 ACCCAGAGATTGGCCCATGCTGG - Intronic
1198408021 X:136335076-136335098 GCCCAGAGATTGTATCGTGAAGG + Intronic
1198815545 X:140586158-140586180 GCACAGAATTTGAACCCTGATGG + Intergenic
1199436342 X:147817127-147817149 ACCCTGACATTTAACCCTGTGGG + Intergenic
1200963647 Y:9017134-9017156 GCCCAGTAATTGAAACCTGATGG + Intergenic
1201287998 Y:12395405-12395427 ACCCAAAGGATGTACCCTGATGG - Intergenic