ID: 1069550429

View in Genome Browser
Species Human (GRCh38)
Location 10:69360394-69360416
Sequence GAAAAGGGCATTTTCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550429_1069550443 26 Left 1069550429 10:69360394-69360416 CCCTGGGTGAAAATGCCCTTTTC No data
Right 1069550443 10:69360443-69360465 CTGGAGGCCCCGGCCTTGTAGGG No data
1069550429_1069550439 16 Left 1069550429 10:69360394-69360416 CCCTGGGTGAAAATGCCCTTTTC No data
Right 1069550439 10:69360433-69360455 CACCCACTTACTGGAGGCCCCGG No data
1069550429_1069550437 10 Left 1069550429 10:69360394-69360416 CCCTGGGTGAAAATGCCCTTTTC No data
Right 1069550437 10:69360427-69360449 TGGCCTCACCCACTTACTGGAGG No data
1069550429_1069550436 7 Left 1069550429 10:69360394-69360416 CCCTGGGTGAAAATGCCCTTTTC No data
Right 1069550436 10:69360424-69360446 CATTGGCCTCACCCACTTACTGG No data
1069550429_1069550432 -10 Left 1069550429 10:69360394-69360416 CCCTGGGTGAAAATGCCCTTTTC No data
Right 1069550432 10:69360407-69360429 TGCCCTTTTCTCCTGGTCATTGG No data
1069550429_1069550442 25 Left 1069550429 10:69360394-69360416 CCCTGGGTGAAAATGCCCTTTTC No data
Right 1069550442 10:69360442-69360464 ACTGGAGGCCCCGGCCTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550429 Original CRISPR GAAAAGGGCATTTTCACCCA GGG (reversed) Intronic