ID: 1069550430

View in Genome Browser
Species Human (GRCh38)
Location 10:69360395-69360417
Sequence AGAAAAGGGCATTTTCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550430_1069550439 15 Left 1069550430 10:69360395-69360417 CCTGGGTGAAAATGCCCTTTTCT No data
Right 1069550439 10:69360433-69360455 CACCCACTTACTGGAGGCCCCGG No data
1069550430_1069550444 30 Left 1069550430 10:69360395-69360417 CCTGGGTGAAAATGCCCTTTTCT No data
Right 1069550444 10:69360448-69360470 GGCCCCGGCCTTGTAGGGTATGG No data
1069550430_1069550436 6 Left 1069550430 10:69360395-69360417 CCTGGGTGAAAATGCCCTTTTCT No data
Right 1069550436 10:69360424-69360446 CATTGGCCTCACCCACTTACTGG No data
1069550430_1069550443 25 Left 1069550430 10:69360395-69360417 CCTGGGTGAAAATGCCCTTTTCT No data
Right 1069550443 10:69360443-69360465 CTGGAGGCCCCGGCCTTGTAGGG No data
1069550430_1069550442 24 Left 1069550430 10:69360395-69360417 CCTGGGTGAAAATGCCCTTTTCT No data
Right 1069550442 10:69360442-69360464 ACTGGAGGCCCCGGCCTTGTAGG No data
1069550430_1069550437 9 Left 1069550430 10:69360395-69360417 CCTGGGTGAAAATGCCCTTTTCT No data
Right 1069550437 10:69360427-69360449 TGGCCTCACCCACTTACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550430 Original CRISPR AGAAAAGGGCATTTTCACCC AGG (reversed) Intronic