ID: 1069550433

View in Genome Browser
Species Human (GRCh38)
Location 10:69360409-69360431
Sequence GGCCAATGACCAGGAGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550433_1069550448 22 Left 1069550433 10:69360409-69360431 CCCTTTTCTCCTGGTCATTGGCC No data
Right 1069550448 10:69360454-69360476 GGCCTTGTAGGGTATGGCTGTGG No data
1069550433_1069550442 10 Left 1069550433 10:69360409-69360431 CCCTTTTCTCCTGGTCATTGGCC No data
Right 1069550442 10:69360442-69360464 ACTGGAGGCCCCGGCCTTGTAGG No data
1069550433_1069550437 -5 Left 1069550433 10:69360409-69360431 CCCTTTTCTCCTGGTCATTGGCC No data
Right 1069550437 10:69360427-69360449 TGGCCTCACCCACTTACTGGAGG No data
1069550433_1069550436 -8 Left 1069550433 10:69360409-69360431 CCCTTTTCTCCTGGTCATTGGCC No data
Right 1069550436 10:69360424-69360446 CATTGGCCTCACCCACTTACTGG No data
1069550433_1069550439 1 Left 1069550433 10:69360409-69360431 CCCTTTTCTCCTGGTCATTGGCC No data
Right 1069550439 10:69360433-69360455 CACCCACTTACTGGAGGCCCCGG No data
1069550433_1069550443 11 Left 1069550433 10:69360409-69360431 CCCTTTTCTCCTGGTCATTGGCC No data
Right 1069550443 10:69360443-69360465 CTGGAGGCCCCGGCCTTGTAGGG No data
1069550433_1069550444 16 Left 1069550433 10:69360409-69360431 CCCTTTTCTCCTGGTCATTGGCC No data
Right 1069550444 10:69360448-69360470 GGCCCCGGCCTTGTAGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550433 Original CRISPR GGCCAATGACCAGGAGAAAA GGG (reversed) Intronic