ID: 1069550434

View in Genome Browser
Species Human (GRCh38)
Location 10:69360410-69360432
Sequence AGGCCAATGACCAGGAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 316}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550434_1069550448 21 Left 1069550434 10:69360410-69360432 CCTTTTCTCCTGGTCATTGGCCT 0: 1
1: 0
2: 3
3: 33
4: 316
Right 1069550448 10:69360454-69360476 GGCCTTGTAGGGTATGGCTGTGG No data
1069550434_1069550437 -6 Left 1069550434 10:69360410-69360432 CCTTTTCTCCTGGTCATTGGCCT 0: 1
1: 0
2: 3
3: 33
4: 316
Right 1069550437 10:69360427-69360449 TGGCCTCACCCACTTACTGGAGG No data
1069550434_1069550436 -9 Left 1069550434 10:69360410-69360432 CCTTTTCTCCTGGTCATTGGCCT 0: 1
1: 0
2: 3
3: 33
4: 316
Right 1069550436 10:69360424-69360446 CATTGGCCTCACCCACTTACTGG No data
1069550434_1069550450 30 Left 1069550434 10:69360410-69360432 CCTTTTCTCCTGGTCATTGGCCT 0: 1
1: 0
2: 3
3: 33
4: 316
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data
1069550434_1069550439 0 Left 1069550434 10:69360410-69360432 CCTTTTCTCCTGGTCATTGGCCT 0: 1
1: 0
2: 3
3: 33
4: 316
Right 1069550439 10:69360433-69360455 CACCCACTTACTGGAGGCCCCGG No data
1069550434_1069550444 15 Left 1069550434 10:69360410-69360432 CCTTTTCTCCTGGTCATTGGCCT 0: 1
1: 0
2: 3
3: 33
4: 316
Right 1069550444 10:69360448-69360470 GGCCCCGGCCTTGTAGGGTATGG No data
1069550434_1069550442 9 Left 1069550434 10:69360410-69360432 CCTTTTCTCCTGGTCATTGGCCT 0: 1
1: 0
2: 3
3: 33
4: 316
Right 1069550442 10:69360442-69360464 ACTGGAGGCCCCGGCCTTGTAGG No data
1069550434_1069550443 10 Left 1069550434 10:69360410-69360432 CCTTTTCTCCTGGTCATTGGCCT 0: 1
1: 0
2: 3
3: 33
4: 316
Right 1069550443 10:69360443-69360465 CTGGAGGCCCCGGCCTTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550434 Original CRISPR AGGCCAATGACCAGGAGAAA AGG (reversed) Intronic
900870723 1:5300745-5300767 ATCCCACTGACCAGGAGGAAGGG + Intergenic
901201889 1:7471846-7471868 AGGTGGAGGACCAGGAGAAAGGG - Intronic
901468024 1:9435711-9435733 AGGTCAATGTCCATGACAAAGGG - Intergenic
901566826 1:10123577-10123599 AGCCCAGTGACCAGCTGAAAGGG + Intronic
901943250 1:12680055-12680077 AGACAGATGAACAGGAGAAAAGG + Intergenic
904544219 1:31255784-31255806 GGGCTACTGACTAGGAGAAAAGG + Intergenic
905367679 1:37463180-37463202 AGGACCAGGACCAGGGGAAAGGG + Intergenic
905417882 1:37816878-37816900 AGGCCAGTGGGCAGGAGAACAGG + Intronic
905882379 1:41472973-41472995 AGACTAATGAACAGGAGAAAAGG + Intergenic
905913591 1:41670331-41670353 AAGCCAATGCCCTGGAGATAGGG - Intronic
906067360 1:42991658-42991680 AGGCAAATTAGTAGGAGAAATGG - Intergenic
906258105 1:44366089-44366111 AGCCCACTCACCTGGAGAAATGG + Intergenic
907228441 1:52971504-52971526 AGGCAGATTAACAGGAGAAAAGG + Intronic
907520155 1:55018562-55018584 AGGGCTATGACAAGGAGGAAGGG + Intergenic
908120871 1:60984823-60984845 AGACCAGTGACTAGGAGAATGGG + Intronic
908696805 1:66853027-66853049 AGGGCCCTGACCAGGAGGAATGG + Intronic
909349181 1:74629601-74629623 AGGAAAATGACCAGGAGAATGGG - Intronic
911096631 1:94060462-94060484 AGGCACATGAACAGGAGGAAAGG + Intronic
911185038 1:94894676-94894698 AGGCAGATTAACAGGAGAAATGG - Intronic
911219616 1:95233699-95233721 AGGGAAGTGACCAGGAGACAAGG - Intronic
912821736 1:112873174-112873196 AGGCAGATTAACAGGAGAAAAGG - Intergenic
913011653 1:114689374-114689396 AGGCCTATGTCCACAAGAAATGG - Intronic
915622592 1:157095074-157095096 AGGACAATGACCCAGAGAGAGGG - Intronic
915723655 1:158002382-158002404 AGGCCACAGACCAGTGGAAATGG - Intronic
916244656 1:162675300-162675322 AAGCCAATGAGTAGAAGAAAGGG + Intronic
916344369 1:163771358-163771380 GGGTCTATTACCAGGAGAAAGGG + Intergenic
917167207 1:172125515-172125537 AGGCTAATCACCAAGAGAAGAGG + Intronic
917489440 1:175485436-175485458 AGGACATTGGCAAGGAGAAAGGG + Intronic
917515011 1:175699918-175699940 AGGCCACTGAGGAGGAGAATAGG - Intronic
917541933 1:175922738-175922760 AGGCAGATGAATAGGAGAAATGG - Intergenic
918340544 1:183564755-183564777 AGGACATTGAGCAGGAGCAACGG + Intronic
918407168 1:184222723-184222745 GGGCAAAAGAGCAGGAGAAAGGG - Intergenic
918982886 1:191586509-191586531 AGGCCAATCATAATGAGAAAAGG + Intergenic
920228667 1:204455902-204455924 AGGCCAGGGACCTGGCGAAATGG + Exonic
920921658 1:210302559-210302581 ATGCCAAAGACCAGGACAGAAGG - Intergenic
921330402 1:214030128-214030150 AAGACAATGTCAAGGAGAAAAGG - Intronic
921356551 1:214289799-214289821 AGGCCACTCATCAGGAGGAAGGG - Intronic
923030581 1:230246360-230246382 AGGTCAAGGAAGAGGAGAAAGGG - Intronic
923148003 1:231211188-231211210 TGGCCAATGGCCAGGAGAGCTGG - Intronic
923549041 1:234946969-234946991 AAGCCAGAGACCAGGAAAAATGG + Intergenic
923780369 1:237017136-237017158 AGGAAGATTACCAGGAGAAATGG - Intergenic
1063283734 10:4660748-4660770 ATGCTAATGTTCAGGAGAAAGGG - Intergenic
1064365424 10:14703194-14703216 AGGCTGATGATTAGGAGAAAAGG - Intronic
1067858131 10:49815409-49815431 AGGAAAATGACCAGAAAAAAAGG + Intergenic
1068327564 10:55514427-55514449 AGGCAGATTAACAGGAGAAAAGG + Intronic
1068574904 10:58674277-58674299 AGTACAATGACAAGGATAAATGG - Intronic
1068620126 10:59173358-59173380 AGGCAGATGAAGAGGAGAAAAGG + Intergenic
1069542450 10:69305435-69305457 AGGCCAGGCACTAGGAGAAAAGG - Intronic
1069550434 10:69360410-69360432 AGGCCAATGACCAGGAGAAAAGG - Intronic
1069959051 10:72068859-72068881 AGAGATATGACCAGGAGAAAAGG - Intronic
1070420238 10:76229215-76229237 AGACCAATCAACAGGAGAAAAGG + Intronic
1071543316 10:86507827-86507849 GGGCTAATGAATAGGAGAAAGGG - Intronic
1073896049 10:108159230-108159252 AGGACAGTGATCACGAGAAAAGG + Intergenic
1074242367 10:111651917-111651939 TGGCCAGTGACCAGGAGTAGAGG - Intergenic
1074328153 10:112473620-112473642 AGGCAGATGACCAAGTGAAAGGG + Intronic
1074636293 10:115321965-115321987 TGAACAATGACTAGGAGAAAAGG + Intronic
1075787588 10:125060690-125060712 AGAACCATGACCAGGAGAGAGGG + Intronic
1077438355 11:2555741-2555763 AGGCCGATGACCAGAAGAAAAGG - Intronic
1077885579 11:6385211-6385233 AGACAAATTAACAGGAGAAAAGG + Intergenic
1078941275 11:16008907-16008929 AGGCCCAAGACCTGGTGAAAAGG - Intronic
1078993840 11:16676432-16676454 TGGCCCATGGACAGGAGAAAAGG - Intronic
1080045724 11:27805646-27805668 AGGCCAAAAACCGGGATAAAGGG + Intergenic
1081077472 11:38694566-38694588 AGGCCAGTGACTAGCAGAAATGG + Intergenic
1083955748 11:65982030-65982052 AGGCCCATCACGAGGAGAGATGG - Intergenic
1085020426 11:73203609-73203631 AGGCAGATGAATAGGAGAAAAGG + Intergenic
1085526703 11:77168102-77168124 ATGCCCAAGACCAGGAGGAATGG - Intronic
1086230301 11:84560990-84561012 AGACCAAACACCATGAGAAAAGG - Intronic
1087939772 11:104081709-104081731 AAGGCAATGACCTGGAAAAATGG - Intronic
1088101768 11:106163797-106163819 AGGCAGATTAACAGGAGAAAAGG - Intergenic
1091534734 12:1395148-1395170 GGGGCAGTGACCAGGAGCAAAGG + Intronic
1091641687 12:2241923-2241945 AGCCCAGGGAGCAGGAGAAATGG - Intronic
1092285115 12:7124232-7124254 AGGTCAAGGACCTTGAGAAAGGG - Intronic
1092951133 12:13504603-13504625 AGGCCCAGTACCAGGAGAAGGGG + Intergenic
1093769932 12:23006605-23006627 AGGCCAAAGAGCATGGGAAAGGG - Intergenic
1094727529 12:33135623-33135645 ATGCTGATGACCAGAAGAAATGG + Intergenic
1094742118 12:33301783-33301805 AGGCAGATTAACAGGAGAAAAGG + Intergenic
1096528875 12:52231195-52231217 AGGACAATGGGAAGGAGAAAAGG - Intergenic
1096554357 12:52394285-52394307 AGGCCAATGCCTAGAACAAAGGG - Exonic
1098440346 12:70511044-70511066 AGGCAAATTAATAGGAGAAAAGG - Intergenic
1098593103 12:72237969-72237991 AGGCCAATGAGCAAAAGAGAGGG + Intronic
1099954670 12:89341966-89341988 TGGCCAATGAACACAAGAAAAGG + Intergenic
1099980019 12:89588385-89588407 AAGGCAATGATGAGGAGAAAAGG + Exonic
1101700955 12:107173294-107173316 ATGCCAAAGACCAAGAGCAAAGG - Intergenic
1101880486 12:108622709-108622731 ACTCCAGTGACCAGGAGAAGCGG + Intronic
1102160233 12:110762937-110762959 AGGCCCAAGACCAGCAGAGAAGG + Intergenic
1102416106 12:112764147-112764169 AGGCAGATTAACAGGAGAAAAGG + Intronic
1102601853 12:114037338-114037360 AATCAAATGGCCAGGAGAAAAGG + Intergenic
1103519446 12:121528156-121528178 AGTAGAATGACCTGGAGAAAGGG - Intronic
1104249001 12:127071846-127071868 AGGCCACAGATCAGGAGAACAGG - Intergenic
1106426952 13:29640539-29640561 AGGCAGATGAAGAGGAGAAAAGG + Intergenic
1106433760 13:29706215-29706237 AGGCCAAAGGCATGGAGAAAAGG - Intergenic
1106836512 13:33640907-33640929 AGGCACATGAATAGGAGAAAAGG + Intergenic
1107122800 13:36813688-36813710 AGGCAGATAAACAGGAGAAAAGG - Intergenic
1109863974 13:68237615-68237637 AGGCAGATTAGCAGGAGAAAAGG - Intergenic
1111528138 13:89500387-89500409 AGACCAAGACCCAGGAGAAAAGG - Intergenic
1112376775 13:98849901-98849923 AGGGCCAAGACCATGAGAAAGGG + Intronic
1112523724 13:100122689-100122711 AGGCCAGTGACCAAGAAAAAAGG - Intronic
1112609803 13:100945421-100945443 AGGGAAGTGACCAGGAGACATGG - Intergenic
1112699689 13:101992054-101992076 AGGCCACAGGCCAGGAGCAAAGG + Intronic
1113162839 13:107402043-107402065 TAGCCCATGATCAGGAGAAAGGG - Intronic
1113536696 13:111072642-111072664 AGGCCAGGGACCCAGAGAAATGG + Intergenic
1114081889 14:19208298-19208320 ATGCAAATGACCAAGAGGAAAGG + Intergenic
1116597011 14:46863133-46863155 AGGCCAAAGAATATGAGAAATGG - Intronic
1116982955 14:51190596-51190618 AGGGAGATGACCATGAGAAAAGG - Intergenic
1117636947 14:57754014-57754036 AGTCCAATTACCAGGACAATAGG + Intronic
1118378663 14:65199776-65199798 AGACCAATGCCATGGAGAAAAGG + Intergenic
1119179039 14:72592128-72592150 AAGCCAATAAGGAGGAGAAAGGG + Intergenic
1119583371 14:75808359-75808381 ACTCCAATCACCAGGAGAGAAGG - Intronic
1120450851 14:84665449-84665471 AGCCCCATCCCCAGGAGAAAGGG - Intergenic
1121640167 14:95479948-95479970 CGGCCAAGGACAATGAGAAAAGG + Intergenic
1123013097 14:105358622-105358644 AGACCCATGACCAGGCGAAGGGG + Intronic
1124044276 15:26134159-26134181 GGGCCAATAAACAGAAGAAAGGG + Intergenic
1124963382 15:34414832-34414854 AGGCAGGTGACCAGGAGAAGGGG + Intronic
1124980003 15:34561058-34561080 AGGCAGGTGACCAGGAGAAGGGG + Intronic
1125150666 15:36528307-36528329 AGGCCACTGACCAACAGAAGGGG + Intergenic
1126057594 15:44745514-44745536 TGGCCCATGGACAGGAGAAAAGG + Intronic
1126925864 15:53585564-53585586 AGACAAATTAACAGGAGAAAAGG - Intronic
1128522483 15:68384995-68385017 TGGCCTATGCCCTGGAGAAAGGG - Intronic
1129510992 15:76122317-76122339 AGGCCAACCACCAGGTAAAAGGG + Intronic
1130561801 15:84964730-84964752 AGGGCCATGACTAGTAGAAAAGG + Intergenic
1133936833 16:10276231-10276253 AGGCAGATGAATAGGAGAAAAGG - Intergenic
1134687207 16:16167203-16167225 AGGCCAATGACAGGGAGACCTGG + Intronic
1135284711 16:21183343-21183365 AGACAGATGAACAGGAGAAAAGG + Intergenic
1136455519 16:30377881-30377903 ACGCCAAGGACCAGGAGTAGGGG + Exonic
1140133160 16:72182146-72182168 ATGCCGGTGACCAGGAGAATAGG - Intergenic
1140932822 16:79643513-79643535 AGGATCAGGACCAGGAGAAATGG + Intergenic
1141280529 16:82626912-82626934 AGGCTGATGACCAGGACCAATGG - Intronic
1141296128 16:82771550-82771572 AGGCAAAGGACATGGAGAAACGG + Intronic
1141385002 16:83614040-83614062 TGACCAAAAACCAGGAGAAAAGG - Intronic
1144258937 17:13498840-13498862 AGGCCGATTCACAGGAGAAAAGG - Intronic
1145040657 17:19575833-19575855 AGGCCGATGAATAAGAGAAAAGG + Intronic
1146001399 17:29132750-29132772 ATGCCAAGGACGAGGGGAAATGG + Intronic
1146627857 17:34447626-34447648 AGGCCAGAAACCAGCAGAAATGG - Intergenic
1147833404 17:43313133-43313155 AGGCAGATTAACAGGAGAAAAGG - Intergenic
1149402626 17:56313547-56313569 AGCCCAAGGACCAAGAGAAAAGG - Intronic
1149550440 17:57535481-57535503 AGGCAAAGGAACAGGAGACACGG + Intronic
1150628634 17:66859958-66859980 ATGCAAAGGCCCAGGAGAAAAGG + Intronic
1151680900 17:75622145-75622167 AGGACAGTGACCAAGAGAAGGGG - Intergenic
1151909633 17:77073554-77073576 ATGCAATTGCCCAGGAGAAAAGG - Intergenic
1152769288 17:82157527-82157549 AGGTGAAGGACCAGGAGAAGAGG + Intronic
1153370962 18:4315422-4315444 AAGCTAATTAGCAGGAGAAAGGG - Intronic
1154236303 18:12609504-12609526 AGGGTAATGAAAAGGAGAAATGG - Intronic
1154377595 18:13822813-13822835 AGACCACTGTCCAGGAGAAACGG + Intergenic
1155081158 18:22411174-22411196 GGCCCAAAGACTAGGAGAAAAGG - Intergenic
1156185434 18:34657215-34657237 ATTCCAATGGACAGGAGAAATGG - Intronic
1159948296 18:74459799-74459821 AGGCGCAGGACAAGGAGAAACGG - Intergenic
1161961219 19:7524349-7524371 AAGCCAAGGACCTGGAGAAGAGG - Intronic
1163976522 19:20858316-20858338 TGACCAGTGACCAGGAGTAAAGG + Intronic
1164946093 19:32294382-32294404 AGGCCAATGACCAGATAAATTGG - Intergenic
1165200717 19:34142216-34142238 AGGCCAATAAGCAGAAGAAAAGG + Intergenic
1167113653 19:47476393-47476415 AGGACAACTCCCAGGAGAAAGGG - Intronic
925571992 2:5322345-5322367 AGGCCTGTCACCACGAGAAAGGG - Intergenic
925581759 2:5417987-5418009 AGGGCAATGCCCAGCAGAACTGG - Intergenic
925676520 2:6367810-6367832 AGGACTGTGAACAGGAGAAAGGG - Intergenic
926591938 2:14749767-14749789 AGGCAAAGGACCACCAGAAAGGG + Intergenic
927981312 2:27376837-27376859 AGGCCCCTGGCCAAGAGAAAAGG - Exonic
928261021 2:29766830-29766852 AAACCCATGTCCAGGAGAAAAGG + Intronic
930165759 2:48202305-48202327 AGGCAGATTAACAGGAGAAAAGG + Intergenic
930302186 2:49630411-49630433 AACCCAATGACCAAGAGAGATGG - Intergenic
931859732 2:66342192-66342214 AGGTCAATGATCATGAGACAGGG + Intergenic
933291618 2:80444501-80444523 AGGACAGTCCCCAGGAGAAAGGG - Intronic
933690446 2:85175479-85175501 AAGCCTATGACCAGGAGGGAGGG - Intronic
933895372 2:86806436-86806458 AGGCCAAGGACAAGGAGGAAGGG - Intronic
935233031 2:101115899-101115921 AGGCCAGCCACCAGGAGAAATGG + Intronic
935472469 2:103476922-103476944 AGGTAAATGACAAGGAAAAAGGG - Intergenic
936454312 2:112659806-112659828 AGGCCTGTGACAAGGATAAATGG - Intronic
937089989 2:119199702-119199724 AGGTCAATGCCCAGGTGAAATGG - Intergenic
938020054 2:127898927-127898949 AGGCAGATTAACAGGAGAAAAGG - Intergenic
938365973 2:130734627-130734649 AGGTCAGAGACCAGGAGAGATGG + Intergenic
938373372 2:130788051-130788073 AGGCAAAGAACCAGAAGAAAAGG + Intergenic
938494694 2:131788299-131788321 ATGCAAATGACCAAGAGGAAAGG - Intergenic
938601418 2:132845229-132845251 AGGCAATAGACTAGGAGAAAAGG - Intronic
938764999 2:134455065-134455087 AGGCAAATGCCCTGGAGACAGGG + Intergenic
939291257 2:140198055-140198077 AGGCCAGTGACCAGGAGATGAGG - Intergenic
940021806 2:149163853-149163875 AGGCAGATTAACAGGAGAAAAGG + Intronic
940769206 2:157822458-157822480 ATGTGAATGACCATGAGAAATGG + Intronic
942339126 2:174924500-174924522 AGGCAGATTAACAGGAGAAAGGG - Intronic
942511342 2:176705560-176705582 GGGCACATGGCCAGGAGAAATGG + Intergenic
944907430 2:204276436-204276458 GGGCCAGTGTCCTGGAGAAAGGG - Intergenic
946451119 2:219780310-219780332 AGGGCAAATATCAGGAGAAAGGG + Intergenic
946550910 2:220801172-220801194 AGGGCAGAGCCCAGGAGAAATGG - Intergenic
947165246 2:227255167-227255189 AAGGCAGTGACCAAGAGAAAAGG + Intronic
947374117 2:229478533-229478555 AATCCAAACACCAGGAGAAAAGG + Intronic
948754801 2:240152944-240152966 AGGGAAATTGCCAGGAGAAAAGG + Intergenic
948872667 2:240811575-240811597 ATGCCAGAGCCCAGGAGAAAGGG + Intronic
948952459 2:241263073-241263095 AGCCGAAAGACAAGGAGAAAGGG + Intronic
1169572989 20:6926847-6926869 AGGCCAATGTCAAGGAGACAGGG + Intergenic
1170041347 20:12043083-12043105 AGGCAGATTAACAGGAGAAAAGG + Intergenic
1171503776 20:25616713-25616735 AGGCCAATTCCCACCAGAAACGG - Intronic
1172156962 20:32833484-32833506 AAGCCTATAACAAGGAGAAAAGG - Intronic
1175103390 20:56596213-56596235 GAGCCAATTCCCAGGAGAAAAGG + Intergenic
1176711936 21:10157823-10157845 ATGCAAATGACCAAGAGGAAAGG - Intergenic
1177403655 21:20638518-20638540 AGACCAAGGACCAGGAGTACAGG + Intergenic
1178455041 21:32741332-32741354 AGGCAAATTAACAGGAGAAAAGG + Intronic
1180137490 21:45871085-45871107 AGCCCAGTGCCCAGGAGAGATGG + Intronic
1180137506 21:45871131-45871153 AGCCCAGTGCCCAGGAGAGATGG + Intronic
1180498884 22:15914372-15914394 ATGCAAATGACCAAGAGGAAAGG - Intergenic
1182630999 22:31685268-31685290 AGGTCCATTTCCAGGAGAAAGGG + Exonic
1183920946 22:41167775-41167797 AGAACAATGGCCAGGAGACAAGG - Intronic
1183959087 22:41400367-41400389 TAGCCAAAGAACAGGAGAAAAGG - Intergenic
1184124938 22:42480425-42480447 AGGCAGATGAATAGGAGAAAGGG - Intergenic
1184133142 22:42529838-42529860 AGGCAGATGAATAGGAGAAAGGG - Intergenic
1184483346 22:44760997-44761019 AGCCCACTGGCCAGGAGAAAGGG + Intronic
1185085210 22:48737241-48737263 AGGACAAAGACCATGAGACAGGG + Intronic
949526989 3:4914792-4914814 AGGACAATGACCAGTTGAAAAGG - Intergenic
950708373 3:14797868-14797890 AGGGCAATGTTCAGGAGAAAGGG - Intergenic
951823474 3:26840722-26840744 AGGCCAAGTGCCAGGAGAAGTGG + Intergenic
952494271 3:33902259-33902281 TGGCCAATTACCAGGAGAGTAGG + Intergenic
952709892 3:36419430-36419452 AGGCAAATGAGTAGAAGAAATGG + Intronic
956346779 3:68288001-68288023 AGGCCACTGTCCAGGAGCCATGG + Intronic
956536343 3:70281083-70281105 AGGCTGATTAACAGGAGAAAAGG - Intergenic
957450815 3:80379713-80379735 AGGCAGATCAACAGGAGAAAAGG + Intergenic
959539754 3:107524866-107524888 AGGCCAATGACCATTAGCAGAGG - Intronic
960353606 3:116623625-116623647 AGACCAATGTCCAGGATGAAAGG + Intronic
962338876 3:134564028-134564050 AGGCCAATGAGCTAGAGAAATGG - Exonic
964307923 3:155360920-155360942 AGGGAAATGAATAGGAGAAAAGG - Intergenic
965321001 3:167251079-167251101 AGGCCACTGACCAGCAGGATGGG + Intronic
967792324 3:193562515-193562537 AGGCAAATGGCAAGGAGAACAGG - Intronic
969557667 4:7923961-7923983 AACCAAATGAGCAGGAGAAAAGG + Intronic
969891600 4:10264929-10264951 AGGACATGGAACAGGAGAAATGG + Intergenic
972782814 4:42300747-42300769 AGACAAATGAACAGGAGAAAAGG + Intergenic
972879471 4:43406456-43406478 ATGCTAATCACCAGGAGAATGGG + Intergenic
974940683 4:68463927-68463949 AGGCAAATGAGAAGTAGAAAGGG - Intronic
976092854 4:81474875-81474897 AAGCCAAGAACCTGGAGAAAAGG + Intronic
976215706 4:82713806-82713828 AGGTCAATGTCTAGGAGAGAGGG - Intronic
976554379 4:86433243-86433265 AGGGCAATTACCAAAAGAAAGGG - Intronic
977145945 4:93440016-93440038 AGGACAAAGACCAGAGGAAATGG + Intronic
978617556 4:110611910-110611932 TGGCCAATGACATGGGGAAAGGG - Intergenic
979491546 4:121334130-121334152 AGGCCAATGACCAGGGGGTATGG + Intronic
980271621 4:130591466-130591488 AGGCAGATTAACAGGAGAAAAGG - Intergenic
980472947 4:133273349-133273371 AGGCAGATTAACAGGAGAAAAGG + Intergenic
981392171 4:144203796-144203818 AGGCAAAGGATCAGGATAAATGG + Intergenic
981893246 4:149764620-149764642 AGGCAAATTAAAAGGAGAAAAGG - Intergenic
984972218 4:185201967-185201989 AGGCAGATTAACAGGAGAAAAGG - Intronic
985048364 4:185965147-185965169 AGGCAAATTAATAGGAGAAAAGG + Intergenic
985062709 4:186094487-186094509 AAGCCATTGACCAGCAGGAATGG - Intergenic
985220967 4:187705112-187705134 AGGCGAATTAACAGGAGAAATGG + Intergenic
985385035 4:189436622-189436644 ATGCCAAGGACCCGGAGAGAAGG - Intergenic
989588564 5:43092734-43092756 AGGCCAATTACTAGGGGAGATGG + Intronic
989848534 5:46177452-46177474 AGGCCAATGACAAAAAAAAAAGG - Intergenic
990795267 5:59532806-59532828 AGGGCAATGACCCTGAGGAATGG - Intronic
992124203 5:73625115-73625137 AGGCCCAGGCCCAGGAGAAGTGG + Intergenic
992653161 5:78881837-78881859 AGGTGAATTAACAGGAGAAAAGG + Intronic
992758648 5:79932551-79932573 TGGCTAATGACCAGGAGGAGAGG + Intergenic
993269301 5:85773517-85773539 AGGCCAAAGGCCTGGAAAAAGGG + Intergenic
995299811 5:110566324-110566346 ATGCCAATGACCAAGACAAAAGG - Intronic
995369475 5:111402764-111402786 AGGCCAGTGAAAAGGAGAAATGG - Intronic
996496900 5:124168734-124168756 AGGCAGATTAACAGGAGAAAAGG + Intergenic
997251878 5:132395139-132395161 GGGCAAATAACAAGGAGAAAAGG - Exonic
997331768 5:133068494-133068516 AGGCCAAGAATCAGGAGAACAGG + Intronic
997590668 5:135070223-135070245 AGTCCAAAGACCAGGAGCAGGGG - Intronic
998043180 5:138966383-138966405 AAGCCTAAGACCAGGAGGAAGGG - Intronic
998368589 5:141646811-141646833 AGGACAAGGACAAAGAGAAAGGG + Intronic
998523675 5:142823247-142823269 AGGACACTGACCTGTAGAAAGGG + Intronic
999196485 5:149784902-149784924 AGGCCAGTGCCCAGGAGATTAGG - Intronic
1000814169 5:165899714-165899736 TGGCCAATGACAAGCAGAAATGG - Intergenic
1001531220 5:172463221-172463243 AGGCCCATGCCCAGGAGAGCTGG - Intergenic
1001650308 5:173311201-173311223 AGGCCCATGCCCAGGAGCAGAGG - Intergenic
1002882003 6:1261434-1261456 AGGCCAACGTCCAAAAGAAATGG + Intergenic
1003123664 6:3338309-3338331 AGGCAGATTAACAGGAGAAAAGG - Intronic
1004380676 6:15129665-15129687 AGGCCAATTTATAGGAGAAAAGG - Intergenic
1004767775 6:18750426-18750448 AGGTCAATGTCAAGAAGAAACGG + Intergenic
1004798744 6:19120485-19120507 AGGTCGATTAACAGGAGAAAAGG + Intergenic
1005161649 6:22871182-22871204 AGGCAGATTAACAGGAGAAAAGG + Intergenic
1006764012 6:36488943-36488965 AGGCCAATGGCCTGGATTAAGGG + Exonic
1007193730 6:40041270-40041292 AGGCCAAGGATGAGGAGAACAGG + Intergenic
1007946637 6:45833071-45833093 AAGCCAATGATCAGGAGACTTGG + Intergenic
1008165284 6:48130447-48130469 GGGCCAAAGATCAGGGGAAAAGG - Intergenic
1010080221 6:71853037-71853059 AGGCCTATGATAAGGAGAGAGGG + Intergenic
1010515465 6:76768584-76768606 AGGCCAAGGCCCTGGAAAAAGGG + Intergenic
1011161325 6:84393521-84393543 AGGGCAATTACCTGGAGAAGAGG + Intergenic
1011193765 6:84762838-84762860 AGGAAAATGACCGGGAGAAAAGG + Intronic
1011260133 6:85461914-85461936 AGGCCAACCACCAGCAGAGAAGG + Intronic
1012856658 6:104509766-104509788 AAGTCAATGCCCAGGAGAAAGGG + Intergenic
1013787746 6:113800682-113800704 AGGGCATTGACTAGGAAAAAGGG + Intergenic
1014543511 6:122704538-122704560 AGGCTAAACTCCAGGAGAAAAGG + Intronic
1017209673 6:151841168-151841190 AGGGCATGGGCCAGGAGAAAGGG - Intronic
1017263841 6:152419047-152419069 AGACCAATTAACAGGAGAAATGG - Intronic
1018783658 6:167091722-167091744 GGACCAGTGCCCAGGAGAAAAGG + Intergenic
1018787611 6:167120506-167120528 AAGGCAATCACAAGGAGAAACGG + Intergenic
1019623371 7:2003216-2003238 AGGCAAGTCACCAGGAGAAACGG + Intronic
1019854770 7:3593692-3593714 TGGCCAGTGAGCAGGAGGAAGGG - Intronic
1022095338 7:27137247-27137269 AGGGGAAAGAGCAGGAGAAAGGG + Intronic
1022379594 7:29847424-29847446 AGGCCAATTAACAGGAGAAAAGG + Intronic
1022969421 7:35503836-35503858 GGGCAAATTAACAGGAGAAAAGG + Intergenic
1023126596 7:36960223-36960245 AGACCAATTAACTGGAGAAAAGG - Intronic
1023189530 7:37564840-37564862 AGGATACAGACCAGGAGAAATGG - Intergenic
1023381059 7:39609179-39609201 AGGCCAGTGATCAGGAGGACTGG + Intronic
1023521293 7:41052623-41052645 AGGCCAATGAATAGGAGGATGGG - Intergenic
1024169969 7:46774751-46774773 AGGCCAATGGCCAGCACATAGGG - Intergenic
1024544168 7:50503021-50503043 AGGCCAACGCCCAGGAGAGGAGG + Intronic
1024599009 7:50963228-50963250 AGACCAAAGCCCAGGAGCAAAGG - Intergenic
1026254223 7:68696941-68696963 AGGCCAATGAGGAGGAGACAGGG - Intergenic
1027488044 7:78786517-78786539 AGTCCAGTGAACAAGAGAAAAGG - Intronic
1027632700 7:80627059-80627081 ATGCCAAAACCCAGGAGAAAAGG - Intronic
1028384365 7:90238082-90238104 AGGCCACTGGCCAGGAGGCAAGG - Intronic
1028838889 7:95404816-95404838 AGGCATATGGCTAGGAGAAATGG - Intergenic
1030125672 7:106150627-106150649 GGGCCAAGGACCAGGAGAGATGG - Intergenic
1031971104 7:128065777-128065799 AGGCAAAAAACCAGGAGAGAAGG - Intronic
1032119959 7:129148535-129148557 AGGCCAGTGTCCATGAGGAAGGG - Intronic
1033222437 7:139537294-139537316 AGACAAATTAGCAGGAGAAAAGG + Intronic
1033256753 7:139807840-139807862 AGGCCATTTACCAGCAGACAGGG - Intronic
1034555063 7:151845197-151845219 AGGCCACAGACGAGGAGAAGAGG - Intronic
1036753571 8:11457700-11457722 GGGCCAAAGACAAGGACAAAGGG - Intronic
1039568633 8:38568635-38568657 AGGCAGATTACCTGGAGAAAAGG + Intergenic
1041742394 8:61169827-61169849 AGACAAATTAACAGGAGAAAAGG - Intronic
1041890449 8:62862721-62862743 AAGTCAATGACCTGAAGAAATGG + Intronic
1042187155 8:66148203-66148225 AGGCCAATGACTAGATGAACTGG + Intronic
1042488088 8:69368644-69368666 AGGCATATTAACAGGAGAAAAGG - Intergenic
1045252024 8:100490343-100490365 AGGCAGATGAATAGGAGAAAAGG - Intergenic
1046058099 8:109102672-109102694 AGGGTAATGGCAAGGAGAAAAGG + Intronic
1047984821 8:130221676-130221698 AGACAAATTAACAGGAGAAAAGG - Intronic
1049606400 8:143531292-143531314 AGACCCATCCCCAGGAGAAAAGG + Intronic
1049626816 8:143627187-143627209 AGGCAGATGAACAGGAGAAAAGG + Intergenic
1052086325 9:24270955-24270977 AGGTCAATAACTTGGAGAAAAGG - Intergenic
1052539570 9:29791753-29791775 AAGCAAATGAAAAGGAGAAAAGG - Intergenic
1053611985 9:39723232-39723254 AGGTAAATTAACAGGAGAAATGG - Intergenic
1053648932 9:40143511-40143533 ATGCAAATGACCAAGAGGAAAGG - Intergenic
1053756812 9:41320342-41320364 ATGCAAATGACCAAGAGGAAAGG + Intergenic
1053870023 9:42481226-42481248 AGGTAAATTAACAGGAGAAATGG - Intergenic
1054086269 9:60747924-60747946 AGGTAAATTAACAGGAGAAATGG + Intergenic
1054241534 9:62619161-62619183 AGGTAAATTAACAGGAGAAATGG + Intergenic
1054329911 9:63741451-63741473 ATGCAAATGACCAAGAGGAAAGG - Intergenic
1054535651 9:66232659-66232681 ATGCAAATGACCAAGAGGAAAGG + Intergenic
1054555660 9:66653684-66653706 AGGTAAATTAACAGGAGAAATGG + Intergenic
1056529012 9:87470548-87470570 AGGCAGATTAACAGGAGAAAAGG - Intergenic
1056708169 9:88969181-88969203 AGGCCACTGACCAAGAGTGACGG + Intergenic
1058450220 9:105089561-105089583 AGGCTAATGTCCTGGGGAAATGG - Intergenic
1059483947 9:114612647-114612669 AGGCCAGTGCCAAGCAGAAAGGG - Intronic
1059834191 9:118131521-118131543 ATGCCTATTACCAGGTGAAAAGG - Intergenic
1061628859 9:131858937-131858959 AGGCCTCTGCCCAGGAGGAATGG - Intergenic
1061646585 9:132007697-132007719 ATGAGAATGATCAGGAGAAAAGG + Intronic
1062261431 9:135665041-135665063 AAGCCAATGACAAGGAGGGAGGG + Intronic
1202796690 9_KI270719v1_random:126812-126834 ATGCAAATGACCAAGAGGAAAGG - Intergenic
1186180436 X:6968140-6968162 AGGCAGATTAACAGGAGAAAAGG - Intergenic
1187103177 X:16215918-16215940 AGGCAGATTAACAGGAGAAAAGG + Intergenic
1187112907 X:16319881-16319903 AGGCAGATTAACAGGAGAAAAGG - Intergenic
1187331200 X:18341310-18341332 AGGCCATTGAGCAGGAGAAGCGG + Intronic
1189135024 X:38540026-38540048 AGGCACATCTCCAGGAGAAATGG + Intronic
1189854617 X:45210991-45211013 AGGCAAATTAACAGAAGAAAAGG - Intergenic
1190066436 X:47244792-47244814 AGGCAATTGTCCAGGAGGAACGG - Exonic
1190379117 X:49821261-49821283 AAGCCAAAAACCTGGAGAAATGG + Intergenic
1192093512 X:68185775-68185797 AGGCTAAAGAAAAGGAGAAAGGG + Intronic
1192115935 X:68411044-68411066 AGGCAAATTAATAGGAGAAAAGG + Intronic
1192728723 X:73780484-73780506 AGGGCAATGACCAGGTTATAGGG + Intergenic
1193903718 X:87217071-87217093 AGGCAGATTAACAGGAGAAAAGG - Intergenic
1194424711 X:93722150-93722172 AGGCCAAAGACCCAGGGAAATGG - Intergenic
1194746059 X:97629585-97629607 AGGCCACTGACTAAGATAAAAGG - Intergenic
1194864417 X:99048500-99048522 AGGGCAATGCAAAGGAGAAATGG - Intergenic
1195910604 X:109885320-109885342 AGGCAAATGAGCAGGAGAAAAGG + Intergenic
1197349848 X:125370172-125370194 AGGCCAATCACCAAGACAAAAGG - Intergenic
1198739558 X:139826818-139826840 AGCACACTGACCAAGAGAAAAGG + Exonic
1200155818 X:153974435-153974457 AGGGCAATGGCCAGGCGAAGTGG + Intronic