ID: 1069550435

View in Genome Browser
Species Human (GRCh38)
Location 10:69360418-69360440
Sequence AGTGGGTGAGGCCAATGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550435_1069550451 23 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT No data
Right 1069550451 10:69360464-69360486 GGTATGGCTGTGGCCTTGTCGGG No data
1069550435_1069550442 1 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT No data
Right 1069550442 10:69360442-69360464 ACTGGAGGCCCCGGCCTTGTAGG No data
1069550435_1069550452 27 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT No data
Right 1069550452 10:69360468-69360490 TGGCTGTGGCCTTGTCGGGCAGG No data
1069550435_1069550448 13 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT No data
Right 1069550448 10:69360454-69360476 GGCCTTGTAGGGTATGGCTGTGG No data
1069550435_1069550439 -8 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT No data
Right 1069550439 10:69360433-69360455 CACCCACTTACTGGAGGCCCCGG No data
1069550435_1069550450 22 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT No data
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data
1069550435_1069550443 2 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT No data
Right 1069550443 10:69360443-69360465 CTGGAGGCCCCGGCCTTGTAGGG No data
1069550435_1069550444 7 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT No data
Right 1069550444 10:69360448-69360470 GGCCCCGGCCTTGTAGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550435 Original CRISPR AGTGGGTGAGGCCAATGACC AGG (reversed) Intronic