ID: 1069550435

View in Genome Browser
Species Human (GRCh38)
Location 10:69360418-69360440
Sequence AGTGGGTGAGGCCAATGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 167}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550435_1069550443 2 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1069550443 10:69360443-69360465 CTGGAGGCCCCGGCCTTGTAGGG No data
1069550435_1069550439 -8 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1069550439 10:69360433-69360455 CACCCACTTACTGGAGGCCCCGG No data
1069550435_1069550451 23 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1069550451 10:69360464-69360486 GGTATGGCTGTGGCCTTGTCGGG No data
1069550435_1069550442 1 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1069550442 10:69360442-69360464 ACTGGAGGCCCCGGCCTTGTAGG No data
1069550435_1069550452 27 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1069550452 10:69360468-69360490 TGGCTGTGGCCTTGTCGGGCAGG No data
1069550435_1069550448 13 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1069550448 10:69360454-69360476 GGCCTTGTAGGGTATGGCTGTGG No data
1069550435_1069550444 7 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1069550444 10:69360448-69360470 GGCCCCGGCCTTGTAGGGTATGG No data
1069550435_1069550450 22 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550435 Original CRISPR AGTGGGTGAGGCCAATGACC AGG (reversed) Intronic
903263763 1:22144361-22144383 AGGGGGTGAGGGCATAGACCTGG - Intergenic
903630461 1:24765458-24765480 AGAGGGTGATGCAAATGACTGGG + Intronic
904090345 1:27940592-27940614 AGTAGCTGAGGCCACAGACCTGG - Intronic
906486487 1:46239312-46239334 AGTTGGTTTGGCCAATGCCCAGG + Intergenic
908595657 1:65686141-65686163 AGTGGGTGCAGCCCATGAGCAGG - Intergenic
911201733 1:95051256-95051278 AGTGGCTCAGGCCAAAAACCTGG + Intronic
913382699 1:118228532-118228554 AATGGGACAGGCCAATCACCTGG + Intergenic
914457437 1:147849157-147849179 ACTAGGTGATGCCAAAGACCTGG - Intergenic
915506594 1:156360809-156360831 AGTGGCTCAGGCCAAACACCTGG + Intronic
915527193 1:156483191-156483213 AGTGGGTGAGGGCAGGGAGCAGG - Intronic
916002424 1:160629785-160629807 AGCGGGTGTGGCCCATGACCAGG + Intronic
920051763 1:203168608-203168630 GGTGGGTCAGGCCATTTACCTGG + Exonic
920821268 1:209383585-209383607 TGTGGGTGAGTCAAATGGCCTGG + Intergenic
1067046746 10:42989510-42989532 GGTGGGTGAGGCTCATGCCCAGG + Intergenic
1067080153 10:43208250-43208272 AGTGGGAGAGGCCAGTGGCTCGG - Intronic
1069550435 10:69360418-69360440 AGTGGGTGAGGCCAATGACCAGG - Intronic
1074437781 10:113448931-113448953 AGTGGCTGAGTCAAATGAGCAGG + Intergenic
1075317016 10:121460899-121460921 CCTGGGCCAGGCCAATGACCAGG - Intergenic
1075873749 10:125789683-125789705 TGTGGATGAGGCCAGTGCCCCGG - Intronic
1077036557 11:498276-498298 AGTGCTTGGGGCCAAGGACCAGG - Intronic
1078534729 11:12163711-12163733 AGAAGGTGAGACCAATGTCCTGG + Intronic
1078941276 11:16008915-16008937 AGTGAGGGAGGCCCAAGACCTGG - Intronic
1079187039 11:18247074-18247096 AGCAGCTGAGGCCAATGCCCAGG - Intronic
1083668599 11:64288375-64288397 AGAGGATGAGGCCAAATACCAGG - Exonic
1084698188 11:70768784-70768806 TGAGGGTGAGGCCAAGGACTTGG + Intronic
1086398825 11:86444090-86444112 AGTGGGTGAGTGCAATGAGAGGG + Intronic
1088981927 11:114871788-114871810 AGTGGGTCAGAACAATGAGCTGG + Intergenic
1088991742 11:114960018-114960040 ATCAGTTGAGGCCAATGACCTGG - Intergenic
1089277042 11:117344288-117344310 AGGGGGTGCGGCCACTGACTTGG + Intronic
1091145649 11:133277541-133277563 AGTGGAAGAGGCCATTGTCCAGG - Intronic
1091774103 12:3173104-3173126 AGTGGCTGTGCCCACTGACCTGG + Intronic
1092269129 12:7008315-7008337 AGTGGCTGAAGTCAAGGACCAGG - Intronic
1102830947 12:115998758-115998780 AGAGGGAGAGGCCAATCAGCAGG + Intronic
1103469124 12:121165904-121165926 AGTGTGAGAGGCCACTGCCCAGG + Intronic
1107404177 13:40097545-40097567 TGTGGGAGAGGCCATTGGCCAGG - Intergenic
1109117209 13:58403510-58403532 ATTTGCTGAGGCCAATGTCCAGG + Intergenic
1109969751 13:69752678-69752700 AGAAGATGAGGCCACTGACCTGG + Intronic
1110252647 13:73397680-73397702 GGGTGGTGAGGCCAATGAGCAGG + Intergenic
1111558828 13:89916810-89916832 AGTGGATGGGGCCAATAAACAGG - Intergenic
1112827214 13:103405602-103405624 AGTTGGTGAGGACACTGACACGG + Intergenic
1113030013 13:105982799-105982821 AGTGCGTGTGGCCAAAGACAGGG + Intergenic
1114742784 14:25115284-25115306 AGTGGGTGATGCATATGAACAGG + Intergenic
1117000249 14:51364651-51364673 AGTGGGAGAGTCCATAGACCAGG + Intergenic
1119363515 14:74071582-74071604 AGTGGTTCAGGCCAATGAAGGGG + Intronic
1122837424 14:104437005-104437027 AGTGGGTGAACCCAAGGGCCAGG + Intergenic
1124410402 15:29432257-29432279 GGTGGGTGAGACCAAAGCCCAGG - Intronic
1126404726 15:48312164-48312186 AGAGGTTGAGGCCAAGAACCAGG + Intergenic
1129241061 15:74252567-74252589 AGTGGAGGAGGCCAAGGCCCAGG + Intronic
1129241242 15:74253380-74253402 AGTGAGGGAGGCCATTGAGCAGG + Intronic
1129460832 15:75699415-75699437 GGTAGCTGAGGCCAGTGACCAGG - Intronic
1129723983 15:77892302-77892324 GGTAGCTGAGGCCAGTGACCAGG + Intergenic
1130212603 15:81938776-81938798 ATTGGCTTAGGCCAATTACCTGG - Intergenic
1131445796 15:92497172-92497194 AGTACGTGAAGCCAAAGACCAGG + Intronic
1132668996 16:1095079-1095101 AGTGGGTGAGGCCAAGGCCGAGG + Intronic
1133364380 16:5199075-5199097 AGAGGGTGACACCTATGACCCGG - Intergenic
1134021839 16:10926431-10926453 AGTGGGTCAGACCAAAAACCTGG - Exonic
1134102670 16:11462920-11462942 AGTGAGACAGGCCGATGACCGGG - Intronic
1134397113 16:13875233-13875255 ATTGGTTGAGTCTAATGACCTGG - Intergenic
1136242471 16:28952544-28952566 AGTGGGGGAGGACAAAGACAGGG - Intronic
1137762315 16:50950557-50950579 CGTGGGTGAGGCCATCGCCCTGG - Intergenic
1139801899 16:69529732-69529754 GGTGGGTGGGGCCAAGGCCCAGG - Intergenic
1142931013 17:3284102-3284124 AGTGGGTGCGGGCAGTGAACTGG + Intergenic
1142944400 17:3412405-3412427 AGTGGGTGCGGGCAGTGAACTGG - Intergenic
1143130554 17:4674488-4674510 GGTGGGTGAGGCCTGTGCCCTGG - Exonic
1144124888 17:12193989-12194011 ACTGCGTGATGCCAATAACCTGG - Intergenic
1144378286 17:14667437-14667459 AGAGGGTGATGCTGATGACCAGG - Intergenic
1145090284 17:19980263-19980285 ATTGGCTGAAGCCAAGGACCCGG + Intergenic
1152573230 17:81129482-81129504 AGCGGGTGGGGCCATTGCCCAGG + Intronic
1152814060 17:82397324-82397346 AGGGGGTGAGGGCAGTGTCCTGG + Intronic
1155222127 18:23695090-23695112 AGTGGCTGAACCCAATGCCCAGG + Intronic
1162574457 19:11490924-11490946 AGTGGCTCAGGCCAAAGTCCTGG + Intronic
1162712847 19:12608981-12609003 ACAGGGTGAGGGCAATGAACAGG + Intronic
1162753522 19:12843444-12843466 TGTGGGTGAAGCCACTGGCCAGG - Intronic
1163021349 19:14482544-14482566 AGTGGTGGGGGCCAATGGCCTGG - Intronic
1164039697 19:21483721-21483743 AGTGGGAGAGGCCCAGGACCTGG - Intronic
1165236531 19:34426589-34426611 AGTGGGTGAGGGCGGGGACCTGG - Intergenic
1165382609 19:35491885-35491907 GGTGGGTTAGGGCAATGACATGG - Intronic
1166350755 19:42196930-42196952 ATGGGGTGGGGCCAATGACATGG + Intergenic
1167703656 19:51065745-51065767 AGAGGGGGAGGCCAGGGACCAGG - Intergenic
1167732078 19:51265673-51265695 ACTGGGTGAGGACAATAAGCGGG + Intronic
926938466 2:18110956-18110978 AGTGGGAGAGGCCAATAACATGG - Intronic
927510726 2:23642450-23642472 AGGGGGTCACCCCAATGACCGGG - Exonic
932563498 2:72891696-72891718 AACTGGTAAGGCCAATGACCTGG - Exonic
933054237 2:77642382-77642404 AGTGGGTAAGGTGAATGAACTGG + Intergenic
935126121 2:100224334-100224356 AGTGGTTGATACCAATGACATGG - Intergenic
935603004 2:104941721-104941743 AGTGAGTGAGGCCAGTGACTGGG - Intergenic
936496999 2:113030948-113030970 AGTGGGTGAGGTCCAGGGCCAGG + Intronic
937093216 2:119220387-119220409 AGTGGGAGAGGGCACTGAGCGGG - Intergenic
937952951 2:127402299-127402321 AGTGGCTGATGACAATGACAAGG - Intergenic
940106045 2:150101516-150101538 TGCGGTTGAGGGCAATGACCTGG + Intergenic
943015166 2:182501720-182501742 AGTGGGTGAGGTCAATGAATTGG - Intronic
943285631 2:185995341-185995363 ATTGGGTGAGTCCTAAGACCTGG - Intergenic
944870658 2:203908497-203908519 AGTGGTGGAGCCCCATGACCTGG + Intergenic
944898424 2:204189317-204189339 ACAGGGTGAGGCCAGTGAACAGG + Intergenic
947604871 2:231479427-231479449 AGTGGCTGTGGCCACTGCCCAGG + Intronic
1169301136 20:4442993-4443015 CCTGGGCGAGGCCAATGAGCGGG - Intergenic
1169701123 20:8447813-8447835 AGTGGGGGAGGGCAAGGACAGGG + Intronic
1173904474 20:46616034-46616056 AGTGTGTGTGTCCAATAACCTGG - Intronic
1174105049 20:48156008-48156030 AGTGGGTGGGGCCTATGTCATGG + Intergenic
1180172644 21:46067786-46067808 AGTGGCTCTGGCCAATGCCCAGG - Intergenic
1180954223 22:19734325-19734347 AGTACGTGAGGCCAAGGACCTGG + Intergenic
1181028758 22:20140151-20140173 AGCCAGTGAGGCCAATGACAGGG - Exonic
1181583999 22:23842965-23842987 AGTGTGTGAGGCCAGTGAGGGGG - Intergenic
1182691383 22:32166063-32166085 AGTGGGTGAGGACAAGGGCCAGG - Intergenic
1183346944 22:37313210-37313232 AGTGGGTGAGGCCTCCGATCAGG - Intronic
1183364564 22:37400161-37400183 GGTGGTTGAGGCCCCTGACCTGG - Intronic
952309695 3:32177142-32177164 GTTGGGTGAGGCCAGTGTCCAGG + Intergenic
952564413 3:34637776-34637798 AGTGTGTGAGACCAAGTACCAGG - Intergenic
953642716 3:44724701-44724723 TGAGGGTGAGGGCAATGACTAGG - Intergenic
953911456 3:46895327-46895349 AGTGGGTGATGTCAATGGACAGG - Intronic
955835892 3:63054738-63054760 AGTGGGTGAGCTCCATGAACAGG - Intergenic
960148768 3:114230993-114231015 AAGGGGTGACGCCAATGATCAGG + Intergenic
961945566 3:130683363-130683385 AGTGGTTGAGACCAAAGACTGGG + Intronic
962416444 3:135186953-135186975 AGTAGGTGGGGCCTGTGACCTGG - Intronic
962441192 3:135417885-135417907 CGTGGGTGAGGGCAATGCCTGGG + Intergenic
964761343 3:160137443-160137465 AGTGGGTGAGACCATTGAGAAGG + Intergenic
966162385 3:176982418-176982440 AGTGTGTGATGACAGTGACCGGG - Intergenic
968187493 3:196643351-196643373 CGTGGGTGAGGACCATGACGAGG - Intronic
968873908 4:3255164-3255186 AGCGGATGACCCCAATGACCAGG - Intronic
968940911 4:3637175-3637197 AGTGGGTAAGACCGAAGACCAGG - Intergenic
969578090 4:8048109-8048131 AGGGAATGAGGACAATGACCTGG - Intronic
969593910 4:8137385-8137407 AGTGGGGGCGGCCAAGGGCCTGG + Intronic
972830461 4:42808989-42809011 AGTGGGTGAAGGAAATGAGCAGG - Intergenic
973045930 4:45534434-45534456 AGTGGAGCAGGCCAATCACCTGG + Intergenic
975029809 4:69600999-69601021 AGTGGGGAAGGCTTATGACCTGG + Intronic
976400032 4:84596954-84596976 GGTGGGTGTGGCCAAAGCCCTGG + Intronic
976854163 4:89583053-89583075 AGAGGGTGAGGCCACTGCCTAGG + Intergenic
977176593 4:93827550-93827572 AGGGGGGGAGGCCAATTCCCAGG - Intergenic
979122860 4:116926052-116926074 AGCGGGTGAGGCCGAGGACCAGG - Intergenic
982404988 4:155009482-155009504 AGTGGGTGTGGCCAAAGACGTGG - Intergenic
982428594 4:155296323-155296345 AGTGGCTGTGGCCAGTGTCCAGG - Intergenic
985681126 5:1256502-1256524 AGTGGGTGAGGCCAGGTACATGG - Intronic
986061246 5:4193213-4193235 AGCGGGTGAGGAGAAGGACCTGG + Intergenic
995706496 5:114993372-114993394 AATGGAGCAGGCCAATGACCTGG + Intergenic
998043183 5:138966391-138966413 AGTGTGTGAAGCCTAAGACCAGG - Intronic
1001166004 5:169368076-169368098 AATGGTTGAGACCTATGACCTGG + Intergenic
1005662443 6:28012534-28012556 TGTGTGTGTGGCCAATGACAAGG - Intergenic
1006991509 6:38218600-38218622 AGTAGGTGTGGCCCATGTCCAGG + Intronic
1007230989 6:40347665-40347687 GGTGGGGGAGGCCAAGGATCTGG + Intergenic
1007383609 6:41505570-41505592 AGTGGGAGAGGATAAAGACCGGG - Intergenic
1011284256 6:85706570-85706592 AGTGGGAGAGGCCAGAGAGCAGG + Intergenic
1011544469 6:88468717-88468739 TGTGGGTGAGGCCCAGGGCCTGG + Intergenic
1015958053 6:138618913-138618935 AGGGGCTGAGGCAAATGACTTGG - Intronic
1016071787 6:139747854-139747876 AGAGAGTGATGCCAATCACCAGG - Intergenic
1017993714 6:159512034-159512056 AGTGGTGATGGCCAATGACCAGG - Intergenic
1019012253 6:168851221-168851243 AGGGGGTGAGGACAATCAGCAGG + Intergenic
1019859380 7:3643465-3643487 AGTGGGAGAGGAGAATCACCAGG - Intronic
1019990861 7:4689837-4689859 ACTGGGTGAGGGCAGTGACAAGG - Intronic
1021063351 7:16141897-16141919 TGTGTGTGAGGACAATGATCTGG - Intronic
1023413391 7:39909793-39909815 AGTGGGGAAGGCTTATGACCTGG + Intergenic
1024282081 7:47726987-47727009 AGATGGAGAAGCCAATGACCTGG - Intronic
1026959307 7:74398525-74398547 AGTGGCTGAGCCCAATGTCTGGG - Intronic
1030041641 7:105456323-105456345 AGTGAGTGATTCCAATAACCTGG + Intronic
1030309861 7:108058266-108058288 AGTGAGTGAGGCCAAAGACCTGG + Intronic
1032063316 7:128743830-128743852 AGTGGGTGAGGAAAATGAGAAGG + Intronic
1032478299 7:132227088-132227110 AGTGGAGGAGGCCACTGAGCTGG - Intronic
1032891060 7:136195487-136195509 ATTTGCTTAGGCCAATGACCTGG + Intergenic
1034387554 7:150753129-150753151 ACTGGGGGAGGCCAGGGACCTGG + Intergenic
1034933965 7:155186417-155186439 AGTGGCTGAGGGCAAAGGCCAGG + Intergenic
1036518036 8:9463679-9463701 AGTGGGTAAGGCAATTGCCCAGG + Intergenic
1039256255 8:35722277-35722299 AAAGGGTGACACCAATGACCAGG - Exonic
1039999630 8:42565167-42565189 AATGGATCAGGCCAATCACCTGG - Intergenic
1044389563 8:91633557-91633579 AGTGGGTGGGGCAAGGGACCAGG + Intergenic
1047512331 8:125525125-125525147 ACTGGGTGAGTCCATGGACCTGG + Intergenic
1048270708 8:133025992-133026014 AGTGTGTGAGGACAAGCACCAGG + Intronic
1048456709 8:134584923-134584945 AGAGGCTGAGGGCAATGTCCAGG + Intronic
1049663404 8:143830661-143830683 AGTGGCTGGGGCTTATGACCTGG - Intergenic
1049790928 8:144472430-144472452 AGTGGGTGAGGCCAGCCACCTGG - Exonic
1052625479 9:30971058-30971080 AGTGTGTGAGAGCAATGACAGGG + Intergenic
1053337529 9:37289098-37289120 AGTTGCTGAGGCCAAAAACCTGG + Intronic
1057762787 9:97890115-97890137 AGTGGGTGAGACCCATGGGCCGG - Intergenic
1059361242 9:113743477-113743499 AGTGTGTGAGACCGATGACCAGG + Intergenic
1060134778 9:121142815-121142837 TGGGGGTGAGGCTAATGAACTGG - Intronic
1061461406 9:130742289-130742311 TGTGGGTAAGGGCATTGACCTGG - Intronic
1062137356 9:134936605-134936627 AATGGGTGAAGACAATGACCAGG + Intergenic
1192042588 X:67638633-67638655 AGTGGGTGAAGGAAATGAACAGG - Intronic
1192381164 X:70618154-70618176 ATTGGCAGTGGCCAATGACCTGG + Intronic
1193164266 X:78263801-78263823 ACTGGGTGAGGCCACTCAACAGG - Intergenic
1193650319 X:84123354-84123376 AGTGGGGTAGGCCAATAAGCAGG + Intronic
1195210844 X:102651556-102651578 GGAGGGGGAGGCCGATGACCTGG + Exonic
1195615248 X:106906713-106906735 GGTGGATGAGGCCAAGGCCCAGG - Intronic
1199736107 X:150688219-150688241 GGTGGGAGAGGTCAGTGACCAGG - Intergenic