ID: 1069550436

View in Genome Browser
Species Human (GRCh38)
Location 10:69360424-69360446
Sequence CATTGGCCTCACCCACTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550433_1069550436 -8 Left 1069550433 10:69360409-69360431 CCCTTTTCTCCTGGTCATTGGCC No data
Right 1069550436 10:69360424-69360446 CATTGGCCTCACCCACTTACTGG No data
1069550425_1069550436 28 Left 1069550425 10:69360373-69360395 CCCAGTGCAGGTTTAGCAGAGCC No data
Right 1069550436 10:69360424-69360446 CATTGGCCTCACCCACTTACTGG No data
1069550424_1069550436 29 Left 1069550424 10:69360372-69360394 CCCCAGTGCAGGTTTAGCAGAGC No data
Right 1069550436 10:69360424-69360446 CATTGGCCTCACCCACTTACTGG No data
1069550426_1069550436 27 Left 1069550426 10:69360374-69360396 CCAGTGCAGGTTTAGCAGAGCCC No data
Right 1069550436 10:69360424-69360446 CATTGGCCTCACCCACTTACTGG No data
1069550434_1069550436 -9 Left 1069550434 10:69360410-69360432 CCTTTTCTCCTGGTCATTGGCCT No data
Right 1069550436 10:69360424-69360446 CATTGGCCTCACCCACTTACTGG No data
1069550430_1069550436 6 Left 1069550430 10:69360395-69360417 CCTGGGTGAAAATGCCCTTTTCT No data
Right 1069550436 10:69360424-69360446 CATTGGCCTCACCCACTTACTGG No data
1069550429_1069550436 7 Left 1069550429 10:69360394-69360416 CCCTGGGTGAAAATGCCCTTTTC No data
Right 1069550436 10:69360424-69360446 CATTGGCCTCACCCACTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550436 Original CRISPR CATTGGCCTCACCCACTTAC TGG Intronic