ID: 1069550437

View in Genome Browser
Species Human (GRCh38)
Location 10:69360427-69360449
Sequence TGGCCTCACCCACTTACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550430_1069550437 9 Left 1069550430 10:69360395-69360417 CCTGGGTGAAAATGCCCTTTTCT No data
Right 1069550437 10:69360427-69360449 TGGCCTCACCCACTTACTGGAGG No data
1069550426_1069550437 30 Left 1069550426 10:69360374-69360396 CCAGTGCAGGTTTAGCAGAGCCC No data
Right 1069550437 10:69360427-69360449 TGGCCTCACCCACTTACTGGAGG No data
1069550433_1069550437 -5 Left 1069550433 10:69360409-69360431 CCCTTTTCTCCTGGTCATTGGCC No data
Right 1069550437 10:69360427-69360449 TGGCCTCACCCACTTACTGGAGG No data
1069550429_1069550437 10 Left 1069550429 10:69360394-69360416 CCCTGGGTGAAAATGCCCTTTTC No data
Right 1069550437 10:69360427-69360449 TGGCCTCACCCACTTACTGGAGG No data
1069550434_1069550437 -6 Left 1069550434 10:69360410-69360432 CCTTTTCTCCTGGTCATTGGCCT No data
Right 1069550437 10:69360427-69360449 TGGCCTCACCCACTTACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550437 Original CRISPR TGGCCTCACCCACTTACTGG AGG Intronic