ID: 1069550438

View in Genome Browser
Species Human (GRCh38)
Location 10:69360430-69360452
Sequence GGGCCTCCAGTAAGTGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550438_1069550443 -10 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC No data
Right 1069550443 10:69360443-69360465 CTGGAGGCCCCGGCCTTGTAGGG No data
1069550438_1069550453 22 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC No data
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550438_1069550452 15 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC No data
Right 1069550452 10:69360468-69360490 TGGCTGTGGCCTTGTCGGGCAGG No data
1069550438_1069550448 1 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC No data
Right 1069550448 10:69360454-69360476 GGCCTTGTAGGGTATGGCTGTGG No data
1069550438_1069550450 10 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC No data
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data
1069550438_1069550451 11 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC No data
Right 1069550451 10:69360464-69360486 GGTATGGCTGTGGCCTTGTCGGG No data
1069550438_1069550444 -5 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC No data
Right 1069550444 10:69360448-69360470 GGCCCCGGCCTTGTAGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550438 Original CRISPR GGGCCTCCAGTAAGTGGGTG AGG (reversed) Intronic