ID: 1069550438

View in Genome Browser
Species Human (GRCh38)
Location 10:69360430-69360452
Sequence GGGCCTCCAGTAAGTGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550438_1069550451 11 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1069550451 10:69360464-69360486 GGTATGGCTGTGGCCTTGTCGGG No data
1069550438_1069550443 -10 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1069550443 10:69360443-69360465 CTGGAGGCCCCGGCCTTGTAGGG No data
1069550438_1069550448 1 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1069550448 10:69360454-69360476 GGCCTTGTAGGGTATGGCTGTGG No data
1069550438_1069550450 10 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data
1069550438_1069550444 -5 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1069550444 10:69360448-69360470 GGCCCCGGCCTTGTAGGGTATGG No data
1069550438_1069550453 22 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550438_1069550452 15 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1069550452 10:69360468-69360490 TGGCTGTGGCCTTGTCGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550438 Original CRISPR GGGCCTCCAGTAAGTGGGTG AGG (reversed) Intronic
900467469 1:2832874-2832896 GAGCCTCCAGAAAGGGGGCGGGG - Intergenic
900862161 1:5241515-5241537 GGGCCTGCAGTGGGTGGGAGTGG - Intergenic
901350841 1:8594818-8594840 GGGCCTCCTGGAAGTGAGTGGGG - Intronic
901794034 1:11670330-11670352 GGGCCTCCATTAGGTGGGCCTGG - Intronic
902469620 1:16639318-16639340 GGGCCGTCAGTCAGTGGTTGTGG - Intergenic
903568000 1:24283548-24283570 GGGCCTCCAAGTAGTAGGTGAGG - Intergenic
903836406 1:26206038-26206060 GGGCCAGAAGAAAGTGGGTGTGG + Intergenic
904316928 1:29671646-29671668 AGGCTTCCTGGAAGTGGGTGGGG + Intergenic
905672463 1:39801013-39801035 GGGCATCCATTCAGTTGGTGGGG - Intergenic
905771646 1:40641869-40641891 GGGCCTCCAGGAATGTGGTGCGG - Exonic
905946817 1:41908118-41908140 GGGCATCTAGTAAGTGGAAGAGG + Intronic
906127912 1:43438975-43438997 GGGCCTGCAGGAGGTGGGTAGGG - Exonic
906733794 1:48105263-48105285 GGGCCTGCAGGGAGTGGGCGAGG - Intergenic
907372113 1:54010372-54010394 GGGCCACAAGGAAGTGGGGGAGG + Exonic
907920955 1:58911188-58911210 GGCCTACCAGTGAGTGGGTGTGG - Intergenic
908268077 1:62397722-62397744 GGGGCTCCAGGTAGTGGGTCTGG - Intergenic
911174651 1:94806846-94806868 GACCCTCCAATCAGTGGGTGTGG - Intergenic
912258028 1:108081033-108081055 GTGGCTCCAGGAACTGGGTGAGG - Intergenic
915096533 1:153466515-153466537 GGGCCTCCAGGGAGCGGCTGGGG + Intergenic
915362755 1:155295633-155295655 GGGCCGCCGGGCAGTGGGTGGGG - Intronic
915467813 1:156107501-156107523 GGGCCTCCTGGAAGTGGGCTGGG + Intronic
915576993 1:156786001-156786023 GGGCCTTCAGTATGTTGGTCAGG + Intronic
915899007 1:159833191-159833213 GGGCCAGCAGTCAGTGGTTGAGG + Intronic
917897347 1:179504676-179504698 GGGCATCCAGTCAGGGGATGGGG - Intronic
919159760 1:193813614-193813636 TGGGCTCCAGTAATTGGATGGGG - Intergenic
919775904 1:201193913-201193935 GAGCCTCTAGGAAGTGGGTGGGG - Intronic
920117394 1:203630210-203630232 GGACCTCCGGTTAGTGGGAGTGG - Intronic
920326721 1:205170746-205170768 GGGTATCCGATAAGTGGGTGGGG + Intronic
924471823 1:244349465-244349487 GGGCCTCCAGAAAGTGCATCGGG + Intergenic
1065562862 10:26980945-26980967 TGGCCTCCTGTAAGGAGGTGAGG + Intergenic
1069268262 10:66491045-66491067 GGCCCTCAAGTAAATGGCTGAGG + Intronic
1069550438 10:69360430-69360452 GGGCCTCCAGTAAGTGGGTGAGG - Intronic
1070645125 10:78196428-78196450 GGGACTCCAGGAAGGGGGTCAGG + Intergenic
1073828487 10:107354868-107354890 GGGCCTCTAGGCAGTGGATGTGG - Intergenic
1075321161 10:121492764-121492786 TGGCCTCCAGTAAGTGGCTTTGG + Intronic
1076068151 10:127464970-127464992 GGGCTTCCAGAAGGTGGGTGCGG + Intergenic
1076604594 10:131681276-131681298 GGCTCTGCACTAAGTGGGTGGGG - Intergenic
1077559541 11:3250250-3250272 GTGCATTCAGTAAGTGGGGGTGG - Intergenic
1077565435 11:3296053-3296075 GTGCATTCAGTAAGTGGGGGTGG - Intergenic
1077914191 11:6600560-6600582 GGGTCTCCTGAAAGTGGCTGAGG - Exonic
1078545307 11:12242589-12242611 TGGCTTCCAAGAAGTGGGTGAGG - Intronic
1079106504 11:17575483-17575505 GGGGCTCCAGGAAGAGGGGGTGG + Intronic
1079114940 11:17634902-17634924 AGTCCTCCTGGAAGTGGGTGAGG - Exonic
1079400907 11:20105681-20105703 GAGCCTCCAGGAAGCGGTTGAGG - Exonic
1085787170 11:79463576-79463598 ATGCCTGCAGCAAGTGGGTGGGG - Intergenic
1088812109 11:113399061-113399083 GGGCCACCAGGAAGTGGAGGGGG - Exonic
1089491342 11:118886022-118886044 GGCCCTTCAGTGAGTGGGTGGGG - Intronic
1090889313 11:130909179-130909201 AGGCATCCAGTAAGTAGATGTGG + Intronic
1091620672 12:2086136-2086158 GGCCCTCCACCAAGTGGGAGAGG - Intronic
1095159935 12:38904950-38904972 AAGGCTCCAGGAAGTGGGTGGGG + Intronic
1096578883 12:52571778-52571800 TGGCCTCCAGTGAGTTGGAGAGG - Intronic
1097244205 12:57597491-57597513 GGATGTCCAGTAAGTGGTTGGGG + Intronic
1100587717 12:95995288-95995310 CGGCCTCCAGTCTGGGGGTGGGG + Intronic
1101305268 12:103521806-103521828 GGGGCTCCACTGAGTGGGAGAGG - Intergenic
1104649856 12:130523727-130523749 GGGCCCTGAGTGAGTGGGTGAGG + Intronic
1114644836 14:24249564-24249586 GGGCCTGGAGTAATTGGGGGTGG + Intronic
1118683953 14:68272354-68272376 GGTCGTCCACTTAGTGGGTGTGG - Intronic
1122205279 14:100145180-100145202 TGGCCTTCAGTTTGTGGGTGAGG + Exonic
1122351310 14:101094824-101094846 GGGCATCCATTCAGTGGGTCGGG - Intergenic
1122464844 14:101925017-101925039 GTGCCGCCAGCGAGTGGGTGAGG + Intronic
1122837486 14:104437283-104437305 GGGCCTCCTGCAGCTGGGTGGGG - Intergenic
1123792616 15:23737407-23737429 GGGCATGCAGTGAGTGGGGGTGG - Intergenic
1123830562 15:24132019-24132041 GAGTCTCCATTAAGTTGGTGGGG + Intergenic
1126229395 15:46307444-46307466 GGGCCTCCAGAAAGTGAGAAAGG + Intergenic
1126477390 15:49079808-49079830 GGGCCTGCAGTCAGTCGGTCGGG - Intergenic
1126822683 15:52520345-52520367 GGGCCTCTAGGCAGTAGGTGAGG - Intronic
1131153303 15:90060103-90060125 GGGGCTGCAGTATGGGGGTGGGG - Intronic
1131672178 15:94631673-94631695 AGGCCTCCAGAAAAGGGGTGGGG - Intergenic
1132764136 16:1525877-1525899 GGGCCCTCAGTTAGTGAGTGCGG - Exonic
1132785982 16:1657140-1657162 GGACCTCAAGGAAGTGGGAGAGG + Intronic
1135606175 16:23826762-23826784 GAGCCTCCAGTACCTAGGTGGGG - Intergenic
1136397156 16:29999385-29999407 GGGCCTCCAGGACGGGAGTGGGG - Intronic
1136531858 16:30875263-30875285 CGGCCTGCAGTAAGCGGGTAGGG - Intronic
1137710012 16:50559987-50560009 GTGGCTCCAGTGAGTGGGTTTGG + Intronic
1137803569 16:51283408-51283430 GGGCCTTGAGTAAGCTGGTGGGG - Intergenic
1140758683 16:78091789-78091811 AGCCCTCCAGCAAATGGGTGGGG - Intergenic
1141196920 16:81867039-81867061 GTGGTACCAGTAAGTGGGTGGGG + Intronic
1141863603 16:86734645-86734667 GGGCCTGCAGCCAGTGGGGGTGG - Intergenic
1142086511 16:88186157-88186179 GGGCGTCCACAAGGTGGGTGTGG + Intergenic
1142631473 17:1229093-1229115 GGGCCACCAGCCAGTGGCTGAGG + Intergenic
1143163685 17:4886975-4886997 TTGCCCCCAGGAAGTGGGTGGGG + Intronic
1143501975 17:7344529-7344551 GTGCCTCCAGGAGCTGGGTGGGG + Exonic
1145245888 17:21269055-21269077 GTGCCACCATTATGTGGGTGTGG + Intergenic
1145273809 17:21418414-21418436 GGTCATGCAGTGAGTGGGTGGGG + Exonic
1146651037 17:34606588-34606610 GGGCTTCCAGGAAGTCTGTGAGG - Intronic
1147705330 17:42421916-42421938 GGGCCTCCTGGAAGCGGGCGGGG - Intronic
1147732795 17:42614403-42614425 GGGCCTCCCCTACCTGGGTGGGG - Exonic
1147740052 17:42666230-42666252 GGGCCTCCCCTACCTGGGTGGGG - Exonic
1147969380 17:44211416-44211438 GGGCCTCCAGAGCCTGGGTGTGG + Intronic
1148438937 17:47701877-47701899 TGGCCTCCAGTAAGCCTGTGGGG - Intronic
1150264018 17:63820222-63820244 GGGCCTCCAGAGATTGGGTGGGG - Intronic
1150528532 17:65952166-65952188 GTGCCTGCAGTCATTGGGTGGGG + Intronic
1151456994 17:74232329-74232351 TGGCCTCCAGAAAGGGGCTGAGG + Intronic
1151758938 17:76089913-76089935 TGGCCTCCAGTAATAGGGTCTGG - Intronic
1152256079 17:79240320-79240342 GGGCCACCAATGAGTGGGAGTGG - Intronic
1152778746 17:82217261-82217283 TGACCTCCAGGAAGTGGCTGTGG - Intergenic
1153227709 18:2910629-2910651 GGGCCTCCTGGAGGGGGGTGGGG + Intronic
1154359687 18:13649163-13649185 GGGCCAACAGTAAATGGGGGAGG + Exonic
1155559478 18:27060471-27060493 GGTACTCCAGGGAGTGGGTGCGG + Intronic
1156453052 18:37277422-37277444 GAGCCTGGAGTAAGTGGGGGAGG - Intronic
1156530471 18:37810188-37810210 GGGCCTGCAGGGAGTGGGTAAGG - Intergenic
1157548790 18:48566408-48566430 GGGCCTCCCCAAAGTTGGTGGGG + Intronic
1160006543 18:75072924-75072946 GCGCCTCCAGTAAGAATGTGTGG + Intergenic
1160346385 18:78135709-78135731 GGGCCTCCACTACATGGGCGAGG + Intergenic
1160733079 19:649898-649920 GGGCCCCTGGTGAGTGGGTGGGG - Intronic
1160733116 19:649990-650012 GGGCCCCTGGTGAGTGGGTGGGG - Intronic
1160733136 19:650036-650058 GGGCCCCTGGTGAGTGGGTGGGG - Intronic
1160733212 19:650220-650242 GGGCCCCTGGTGAGTGGGTGGGG - Exonic
1160873477 19:1287071-1287093 GGGCCTGCAGCAGGCGGGTGCGG - Intronic
1160961033 19:1720938-1720960 GGGCCTCCAGAAAGAAGGGGGGG - Intergenic
1162045591 19:7998146-7998168 GGGCCTCCAGAGAGTGGGGTGGG - Intronic
1162099782 19:8332968-8332990 GGGACACCAGGAAATGGGTGGGG - Intronic
1163378213 19:16947270-16947292 GGGCCTCCAGGCACTGGGAGGGG - Intronic
1165797576 19:38527844-38527866 GGGCTTCAAGGATGTGGGTGGGG + Intronic
1165800797 19:38548408-38548430 GGACTTCCAGAAGGTGGGTGTGG + Exonic
1167316458 19:48766177-48766199 GGGGCTCCAGTGAGTAGGTGAGG - Intergenic
1167316823 19:48768559-48768581 GGGGCTCCAGTGAGTAGGTGAGG - Intergenic
1167493170 19:49803268-49803290 CGGCCTGCAGTAGGTGGGGGAGG - Exonic
925365825 2:3311706-3311728 GGGCCTCCAGTCACGAGGTGTGG + Intronic
926247144 2:11130017-11130039 GGGCCTACAGGAAGTGGGCGGGG + Intergenic
926806061 2:16712299-16712321 GTGTCTCCAGGAGGTGGGTGGGG + Intergenic
928415087 2:31085336-31085358 GGGCCTCCAGAGAGAGGGAGGGG + Intronic
929750928 2:44712708-44712730 AGTCCTCCAGAAGGTGGGTGCGG + Intronic
929846444 2:45534009-45534031 GGGGCTACAGTGAGGGGGTGGGG + Intronic
934943377 2:98518644-98518666 GGGCCTACAGTTTGTGAGTGGGG + Intronic
939065115 2:137473908-137473930 GGAACTCCTGAAAGTGGGTGAGG + Intronic
940850136 2:158680124-158680146 GGGCCTCCAGTAAAGAGGGGAGG + Intronic
946386288 2:219386360-219386382 GGGCTTCCAGCAAGTCGGTGTGG - Exonic
946396579 2:219446406-219446428 GAGCCTCTGGGAAGTGGGTGAGG - Intronic
946632746 2:221688942-221688964 GGGTCTCCTTAAAGTGGGTGGGG + Intergenic
1170770726 20:19330221-19330243 GGGCCTCCAATCGGTGGGTCTGG + Intronic
1171328559 20:24317808-24317830 GGTCCTGGAGGAAGTGGGTGGGG - Intergenic
1173579128 20:44133576-44133598 GGGCCTCCAGTCAGTCGGCTGGG - Intronic
1174104073 20:48149680-48149702 GGGCCTCCAGAAAGTGGCCAGGG + Intergenic
1174402199 20:50282162-50282184 GGGCCTCCAGAAAAGGGCTGAGG - Intergenic
1175969092 20:62674912-62674934 GGGACTCCAGAATGTGGGTAAGG + Intronic
1176120351 20:63451773-63451795 GGGTCTCCAGCGAGTGGGAGGGG - Intronic
1176228835 20:64020059-64020081 AGGCCACCAGGAAGTGGGTCAGG - Intronic
1176309513 21:5142238-5142260 GGGGCTCCAGTACGTGGCCGAGG - Intronic
1179847547 21:44119795-44119817 GGGGCTCCAGTACGTGGCCGAGG + Intronic
1180153957 21:45968642-45968664 TTGCCTCCAGGAGGTGGGTGGGG + Intergenic
1181584960 22:23848211-23848233 GGGCCTCTTGGAAGGGGGTGGGG - Intergenic
1184582009 22:45424299-45424321 GGGCCTCCAGTTCTTGGGTCGGG + Intronic
950126713 3:10514255-10514277 GGGTGTCCAGTGAGTGGTTGAGG + Intronic
950522657 3:13505851-13505873 GGACCTCCAGGAAGTGGGCGGGG + Exonic
950704782 3:14772997-14773019 GGGCCTCCAGCATTGGGGTGAGG + Exonic
954030736 3:47818206-47818228 AGCCCTCCAGAAAGTGAGTGAGG + Intronic
954786753 3:53099016-53099038 GGTCCTCCAGTAAGTTACTGAGG - Intronic
961089522 3:124098329-124098351 GGGCCCACAGTGAATGGGTGGGG - Intronic
964832589 3:160901608-160901630 GGTCCTGAAGTAAGTGGGGGAGG - Intronic
966465326 3:180225307-180225329 TTGCCTCCAGTATGTGGGTTAGG - Intergenic
968312841 3:197698311-197698333 TGGCCTCCTGGAAGTGGGTGAGG - Intronic
968766186 4:2470755-2470777 GGTCCTCCTGTAGCTGGGTGAGG + Intronic
969178510 4:5419114-5419136 GGGCCTCCAGCAAGAGAGAGGGG + Intronic
974389367 4:61245551-61245573 TGGCCTCCAGTAATTGCATGTGG - Intronic
978878680 4:113673687-113673709 GGGCAGCCAGTGAGTGGGAGAGG + Intronic
990358519 5:54995233-54995255 GGGCCTGGAGGAAGTTGGTGAGG - Intronic
990524552 5:56612031-56612053 GGACATATAGTAAGTGGGTGAGG + Intergenic
990950190 5:61291106-61291128 GGAGCTACAGGAAGTGGGTGGGG - Intergenic
998365435 5:141627825-141627847 TGGACTTCAGTACGTGGGTGGGG - Intronic
1001414656 5:171536565-171536587 GGGCCATCAGTCAGTGAGTGTGG + Intergenic
1001541670 5:172543941-172543963 GGGCCTTTAGTAAGTAGGTAAGG - Intergenic
1007581409 6:42962400-42962422 GGGGCTCCTTTAAGTGGGGGCGG + Intronic
1008877621 6:56346963-56346985 GGGCCTCCTGCAAGAGGCTGTGG - Intronic
1013349155 6:109290425-109290447 GCGCCTCCAGGCAGTCGGTGTGG + Intergenic
1013771549 6:113633240-113633262 GAGCCACCTGTAGGTGGGTGAGG + Intergenic
1016000648 6:139037633-139037655 AGGCCTCCATCAAGTGGGTGTGG - Intronic
1018371604 6:163173645-163173667 GGACCTCCAGAACGTGGGTGTGG + Intronic
1018468748 6:164078319-164078341 AGGATTCCAGGAAGTGGGTGGGG - Intergenic
1019174431 6:170153014-170153036 GGGCCTCCAGCCAGCCGGTGGGG - Intergenic
1019681890 7:2355067-2355089 AGGCCTCCAGTGAGGAGGTGGGG + Exonic
1019726080 7:2603391-2603413 TGCCCTCCAGTGAGCGGGTGAGG + Intronic
1019993950 7:4711350-4711372 GGGCTTCCTGTGAGAGGGTGTGG + Intronic
1020993591 7:15233337-15233359 GTGACTCCAGGAAGTGAGTGTGG - Intronic
1022245464 7:28554727-28554749 GGGCCTCCAATAAGAGGCTGTGG - Intronic
1024511540 7:50208172-50208194 TGGCCACCAGAAGGTGGGTGAGG + Intergenic
1026441517 7:70448729-70448751 GGACGTCCAGTAAAGGGGTGAGG - Intronic
1029186317 7:98741384-98741406 GGGTCTCCAGGAAGCGGTTGAGG + Intergenic
1035731402 8:1856114-1856136 GACCCTCTAGGAAGTGGGTGAGG + Intronic
1037949044 8:23007010-23007032 GGTCCTCCAGGAGGTGGGCGGGG - Exonic
1040789265 8:51205948-51205970 GGGCCAGCAGAAAGGGGGTGAGG + Intergenic
1044346428 8:91109698-91109720 GGGCCAGCAGTAAGAGGTTGTGG + Intronic
1045525924 8:102941283-102941305 GGGCAGCCAGTAAGGGAGTGGGG + Intronic
1045553688 8:103195136-103195158 GGGACTCCAGTAAGGTGCTGAGG - Intronic
1046787205 8:118280786-118280808 GGGCCTCCAGCATTTTGGTGGGG + Intronic
1047828047 8:128599645-128599667 GAGCCTTCAGTAAGTTGCTGGGG - Intergenic
1049588144 8:143441308-143441330 GGGCCTCTTGTGGGTGGGTGAGG - Intronic
1049716977 8:144097656-144097678 GGGAGTCCAGACAGTGGGTGTGG + Intergenic
1049835024 8:144730021-144730043 CGGCCTCGAGTTGGTGGGTGAGG - Intronic
1050058271 9:1678329-1678351 GGACCTCCAGTAAGAGGTTTAGG - Intergenic
1051351789 9:16204467-16204489 GGGTCTCCACTTAGTGTGTGAGG + Intronic
1052837841 9:33264805-33264827 GGGCCTCAGTTGAGTGGGTGGGG - Intergenic
1056710345 9:88987512-88987534 GGCCCTCAACTAATTGGGTGAGG + Intergenic
1058234073 9:102467371-102467393 GGGACTCCAGGAAAAGGGTGTGG + Intergenic
1060825673 9:126686560-126686582 CGGCCTCCAGAAGGTGGGGGTGG - Intronic
1061811299 9:133163974-133163996 GGGCCTGCGGTAGGTGGGCGGGG - Intergenic
1061913680 9:133738194-133738216 GGGCCTCCCCTATGTGGGCGGGG - Intronic
1062011752 9:134270897-134270919 GGGCCAACAGTGAGTGGGGGAGG + Intergenic
1187209127 X:17211633-17211655 GGGACTAGAGTAAGTAGGTGAGG - Intergenic
1193253362 X:79319281-79319303 TGGCCTCCTGTCAGTAGGTGGGG + Intergenic
1200069676 X:153521942-153521964 GTGCCACCAGGGAGTGGGTGTGG - Intronic