ID: 1069550439

View in Genome Browser
Species Human (GRCh38)
Location 10:69360433-69360455
Sequence CACCCACTTACTGGAGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550429_1069550439 16 Left 1069550429 10:69360394-69360416 CCCTGGGTGAAAATGCCCTTTTC No data
Right 1069550439 10:69360433-69360455 CACCCACTTACTGGAGGCCCCGG No data
1069550433_1069550439 1 Left 1069550433 10:69360409-69360431 CCCTTTTCTCCTGGTCATTGGCC No data
Right 1069550439 10:69360433-69360455 CACCCACTTACTGGAGGCCCCGG No data
1069550430_1069550439 15 Left 1069550430 10:69360395-69360417 CCTGGGTGAAAATGCCCTTTTCT No data
Right 1069550439 10:69360433-69360455 CACCCACTTACTGGAGGCCCCGG No data
1069550434_1069550439 0 Left 1069550434 10:69360410-69360432 CCTTTTCTCCTGGTCATTGGCCT No data
Right 1069550439 10:69360433-69360455 CACCCACTTACTGGAGGCCCCGG No data
1069550435_1069550439 -8 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1069550439 10:69360433-69360455 CACCCACTTACTGGAGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550439 Original CRISPR CACCCACTTACTGGAGGCCC CGG Intronic