ID: 1069550440

View in Genome Browser
Species Human (GRCh38)
Location 10:69360435-69360457
Sequence GGCCGGGGCCTCCAGTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550440_1069550451 6 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC No data
Right 1069550451 10:69360464-69360486 GGTATGGCTGTGGCCTTGTCGGG No data
1069550440_1069550444 -10 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC No data
Right 1069550444 10:69360448-69360470 GGCCCCGGCCTTGTAGGGTATGG No data
1069550440_1069550452 10 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC No data
Right 1069550452 10:69360468-69360490 TGGCTGTGGCCTTGTCGGGCAGG No data
1069550440_1069550453 17 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC No data
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550440_1069550448 -4 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC No data
Right 1069550448 10:69360454-69360476 GGCCTTGTAGGGTATGGCTGTGG No data
1069550440_1069550450 5 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC No data
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550440 Original CRISPR GGCCGGGGCCTCCAGTAAGT GGG (reversed) Intronic