ID: 1069550440

View in Genome Browser
Species Human (GRCh38)
Location 10:69360435-69360457
Sequence GGCCGGGGCCTCCAGTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550440_1069550451 6 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC 0: 1
1: 0
2: 1
3: 11
4: 80
Right 1069550451 10:69360464-69360486 GGTATGGCTGTGGCCTTGTCGGG No data
1069550440_1069550452 10 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC 0: 1
1: 0
2: 1
3: 11
4: 80
Right 1069550452 10:69360468-69360490 TGGCTGTGGCCTTGTCGGGCAGG No data
1069550440_1069550453 17 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC 0: 1
1: 0
2: 1
3: 11
4: 80
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550440_1069550450 5 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC 0: 1
1: 0
2: 1
3: 11
4: 80
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data
1069550440_1069550448 -4 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC 0: 1
1: 0
2: 1
3: 11
4: 80
Right 1069550448 10:69360454-69360476 GGCCTTGTAGGGTATGGCTGTGG No data
1069550440_1069550444 -10 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC 0: 1
1: 0
2: 1
3: 11
4: 80
Right 1069550444 10:69360448-69360470 GGCCCCGGCCTTGTAGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550440 Original CRISPR GGCCGGGGCCTCCAGTAAGT GGG (reversed) Intronic
900111055 1:1005817-1005839 GGCCTGGGTCTCCAGTGGGTCGG + Intergenic
900565054 1:3328062-3328084 GGCTGGGGCCTCCAGGAAGCTGG + Intronic
902902496 1:19529089-19529111 GCCCGGGGCCTGCAGTGAGGGGG - Intergenic
909110224 1:71466353-71466375 GTCCAGGGCCTCCAGCAAGGAGG - Intronic
910305768 1:85761522-85761544 AACCAGGGCCTCCAGTGAGTTGG - Exonic
912514601 1:110210204-110210226 CGCCAGGGCCTGCAGTGAGTCGG + Intergenic
1069550440 10:69360435-69360457 GGCCGGGGCCTCCAGTAAGTGGG - Intronic
1070327385 10:75397404-75397426 GGCCGGGGCCTCGGGGACGTGGG - Intergenic
1073287326 10:102396775-102396797 GCCCGGTGCCTCCAGTGAGAAGG + Exonic
1075592544 10:123703147-123703169 GGCCGAGGTCTCCAGGAGGTCGG + Intergenic
1076507437 10:130987421-130987443 GGCCAGGGCATCCAGCCAGTGGG + Intergenic
1077036392 11:496877-496899 GGGCGGGGCTTCCAGGAAGATGG + Intronic
1082918445 11:58465230-58465252 GGCAAGGGCCCCCAGTAAGGGGG + Intergenic
1084117998 11:67053009-67053031 GGCCTGGGGCTCCAGTTAGATGG + Intergenic
1085458850 11:76681077-76681099 GACTGGGGCCTCCAGCAAGAGGG + Intergenic
1086792613 11:91061914-91061936 GGCTGGGCCCTACAGTAAGGAGG + Intergenic
1103951065 12:124551451-124551473 GGCGGTGGCCTCCAGGAAGGGGG + Intronic
1104696872 12:130870962-130870984 GGCAGGGGCGCCCAGGAAGTCGG + Intergenic
1107759721 13:43665030-43665052 GGCCCAGGCCTCCAGGAAGGTGG - Intronic
1116846377 14:49868221-49868243 AGGCGGGGCCACCAGCAAGTGGG + Intergenic
1119551086 14:75514626-75514648 GGCGGAGCCCTCCAGTAAGGGGG - Intergenic
1119567646 14:75642126-75642148 GGCCGGGGGCTCCAGAAAGAGGG - Intronic
1126477392 15:49079813-49079835 CGGCGGGGCCTGCAGTCAGTCGG - Intergenic
1129738634 15:77979199-77979221 AGCCGGAGCCTCCAGCATGTTGG + Intergenic
1129847438 15:78774415-78774437 AGCCGGAGCCTCCAGCATGTTGG - Intronic
1132524376 16:407093-407115 GGTCGAGGGCTCCAGTAGGTGGG - Intronic
1132552302 16:558595-558617 GGCCAGAGCCTCCAGCCAGTTGG + Intergenic
1132567340 16:629596-629618 GGCCAGGTCCTCCAGTCAGTCGG + Intronic
1135714418 16:24749326-24749348 GGCAGCAGCCTCCAGTAAGATGG + Intronic
1136113146 16:28077645-28077667 GCCCTCGCCCTCCAGTAAGTTGG + Intergenic
1136487954 16:30585367-30585389 GGCCGGGACCCCCAGTCCGTCGG - Intronic
1138280466 16:55768979-55769001 GGCCGGCGCCTGCAGTATGCTGG + Intergenic
1141151981 16:81570599-81570621 TGCTGGGGCCTCCAGGAAGAAGG - Intronic
1141419017 16:83899620-83899642 GGCCTGCGCCTCCAGCAGGTCGG - Exonic
1142078536 16:88134735-88134757 GGCCTGGGCCTCGAGCAAGCTGG + Intergenic
1145010611 17:19365533-19365555 GGCTGAGGCCTCCAGCAAGAAGG - Intronic
1150657775 17:67051583-67051605 GGAGGGGGCCTCCAGTGGGTAGG - Intronic
1151758940 17:76089918-76089940 CGCCGTGGCCTCCAGTAATAGGG - Intronic
1152376538 17:79921511-79921533 GGCTGGGGCCTCCAGTGAGTGGG - Intergenic
1155247414 18:23923643-23923665 GGCCTGGGCCTCCAGAAAGGAGG + Intronic
1157308846 18:46536884-46536906 GGCTGGGCCCTCCAGGCAGTGGG - Intronic
1160777823 19:864382-864404 GTCCAGGGCCTCCAGCAAGCAGG - Intergenic
1161046428 19:2137214-2137236 CGCTGGGGCCACCAGCAAGTGGG + Intronic
1162199403 19:9009833-9009855 GACTGGGGCGTCCAGTCAGTCGG - Intergenic
1167009388 19:46796704-46796726 GGCCTGGGGCTCCAGGAAGGGGG + Intergenic
926247141 2:11130012-11130034 GGCGGGGGCCTACAGGAAGTGGG + Intergenic
929889039 2:45904631-45904653 GGCCAGGGCTTACTGTAAGTGGG + Intronic
934781473 2:96972124-96972146 GGCGGGGGGCTCCAGTCAGTGGG + Exonic
938248742 2:129797851-129797873 GTCCGGGGCCTCCAGCAGCTCGG + Intergenic
940619776 2:156097089-156097111 TGCCGGGGCCTCCAGTGAATGGG + Intergenic
948901147 2:240957512-240957534 GGCCGGGGCGTCCAGGCAGCGGG + Intronic
1173579130 20:44133581-44133603 TGCTGGGGCCTCCAGTCAGTCGG - Intronic
1176114865 20:63427813-63427835 GGCAGGGGCTTCCAGTGGGTTGG - Intronic
1179064171 21:38008644-38008666 GGCCAGGGCCTTGAGGAAGTAGG + Intronic
1182774101 22:32818396-32818418 GGCCAGTGCCTCCAGAAAATGGG + Intronic
1185399113 22:50606839-50606861 GGCAGGGGTGTCCAGTAGGTGGG + Intronic
949893241 3:8748984-8749006 GGCCGGGGTTGCCAGGAAGTGGG - Intronic
952970548 3:38648269-38648291 GGCCTGGGCCCCCAGTAGCTGGG + Intronic
961664793 3:128488542-128488564 GGCCGGTGGCTCCAGAAAGGGGG + Intronic
966465327 3:180225312-180225334 GGCAGTTGCCTCCAGTATGTGGG - Intergenic
967367072 3:188699331-188699353 GGCCTGGGCATCCAGTCAGGGGG - Intronic
968253894 3:197247881-197247903 GCAAGGGACCTCCAGTAAGTGGG - Intronic
968312843 3:197698316-197698338 AGCCGTGGCCTCCTGGAAGTGGG - Intronic
969709207 4:8833048-8833070 AGCCGGGTCCTCCAGGAAGACGG + Intergenic
975870703 4:78776153-78776175 GGCCGGCCCCTCCAGGGAGTGGG - Intergenic
985530133 5:429322-429344 GGCCGGGGCCGCCAGGATGCCGG + Intronic
1002523491 5:179803808-179803830 GGCCAGGGCCTGCAGTGTGTAGG - Intronic
1003256593 6:4480524-4480546 AGCTGGGGCCTGCAGGAAGTAGG + Intergenic
1007503286 6:42315115-42315137 GGACGGGGTCTCCATTATGTAGG + Intronic
1008525513 6:52403455-52403477 GGCCAGGGCTGCCAGTAAATGGG - Exonic
1010302909 6:74282458-74282480 GGCCTTGGTCACCAGTAAGTTGG + Intergenic
1016960557 6:149668912-149668934 GGGCGGGGGCACCAGTAAGTGGG - Intronic
1017326191 6:153143744-153143766 TGACTGGGACTCCAGTAAGTTGG + Intergenic
1018950672 6:168376936-168376958 GGTGGGGCCCTCCAGGAAGTGGG - Intergenic
1019681886 7:2355062-2355084 GACCGAGGCCTCCAGTGAGGAGG + Exonic
1021451200 7:20785129-20785151 GGCCGGCGCCTCCAGCTGGTGGG - Exonic
1024710972 7:52014369-52014391 GGCCTGGGCCTCCAGTAGTATGG + Intergenic
1026864115 7:73811984-73812006 AGCAGGGACCTCCAGCAAGTAGG - Intronic
1033399435 7:141007813-141007835 TGACGGGGCCTGCAGTAGGTGGG - Intronic
1035251805 7:157602785-157602807 GGCCGTGGCCTGCAGGCAGTTGG + Intronic
1052825157 9:33168682-33168704 GGCTGGGGCCTTCAGCAACTGGG - Intergenic
1061076624 9:128345337-128345359 GCCCCGGGCCTGCAGGAAGTTGG - Exonic
1061811302 9:133163979-133164001 GGGCGGGGCCTGCGGTAGGTGGG - Intergenic
1061913683 9:133738199-133738221 GGCTGGGGCCTCCCCTATGTGGG - Intronic
1203778284 EBV:86180-86202 GGCCGGGGCCTCCATCCAGTGGG + Intergenic
1185503127 X:613923-613945 GGCTGTGTCCTCCAGTAAGATGG + Intergenic
1190266397 X:48829647-48829669 GGCCGAGGTCTCCACGAAGTGGG - Exonic
1190308778 X:49101890-49101912 GGCCGGGGCCTCTCGTTGGTGGG + Intergenic
1192344665 X:70291095-70291117 TGCCTGGGCCTCAAGTAGGTTGG - Intronic
1192432357 X:71121034-71121056 GGCCAGGGCCTGCAGGAAGTGGG + Exonic
1192848152 X:74926127-74926149 GGCCTGGGCCCCCAGGAAGGTGG + Intergenic
1194549147 X:95274350-95274372 GGCAGAGGCCTCCAGTAGGGTGG + Intergenic
1197248179 X:124188034-124188056 GGGCGGGGCCTCAAGTATGCAGG - Intronic