ID: 1069550441

View in Genome Browser
Species Human (GRCh38)
Location 10:69360436-69360458
Sequence AGGCCGGGGCCTCCAGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550441_1069550448 -5 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT 0: 1
1: 0
2: 3
3: 17
4: 111
Right 1069550448 10:69360454-69360476 GGCCTTGTAGGGTATGGCTGTGG No data
1069550441_1069550453 16 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT 0: 1
1: 0
2: 3
3: 17
4: 111
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550441_1069550451 5 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT 0: 1
1: 0
2: 3
3: 17
4: 111
Right 1069550451 10:69360464-69360486 GGTATGGCTGTGGCCTTGTCGGG No data
1069550441_1069550450 4 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT 0: 1
1: 0
2: 3
3: 17
4: 111
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data
1069550441_1069550452 9 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT 0: 1
1: 0
2: 3
3: 17
4: 111
Right 1069550452 10:69360468-69360490 TGGCTGTGGCCTTGTCGGGCAGG No data
1069550441_1069550455 30 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT 0: 1
1: 0
2: 3
3: 17
4: 111
Right 1069550455 10:69360489-69360511 GGAATGAGGTCTCACAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550441 Original CRISPR AGGCCGGGGCCTCCAGTAAG TGG (reversed) Intronic
900142590 1:1144898-1144920 AGGCCGGGGACTCCCGCCAGGGG - Intergenic
900182992 1:1320599-1320621 AGGGAGGGGCCCCCAGGAAGGGG + Intronic
902902497 1:19529090-19529112 AGCCCGGGGCCTGCAGTGAGGGG - Intergenic
903178855 1:21595470-21595492 AGGAGGGGGCCTCGAGTAAAGGG - Intergenic
904033871 1:27549027-27549049 AGGCAGGGGCCCCCGGTAGGCGG + Exonic
904329714 1:29750538-29750560 AAGCCAGGCCCCCCAGTAAGAGG + Intergenic
904602935 1:31683723-31683745 GAGCCAGGGCCTCCAGGAAGGGG - Exonic
904936253 1:34131760-34131782 AGGCCAGAGTCTCCAGTCAGGGG + Intronic
906673560 1:47677358-47677380 AGGCCGGGGCCTCCTGGGAAGGG - Intergenic
908897624 1:68918243-68918265 AGGCCTTAACCTCCAGTAAGGGG - Intergenic
911133932 1:94418861-94418883 AGGCAGCGGCCTCCAGTTGGGGG + Intronic
912569552 1:110611352-110611374 AGGCCCAGGCCTCCATGAAGGGG - Intronic
921053664 1:211528177-211528199 AGGCCAGGGCCTCCAGAGGGTGG + Intergenic
922799941 1:228360548-228360570 GAGCCGGGGCCTCCCGCAAGAGG - Intronic
922802335 1:228370180-228370202 AGGCCGGGCCCTACAGGGAGAGG - Exonic
923400930 1:233614697-233614719 AGGCCGGGGACGCCAGTAAGGGG - Intronic
1069550441 10:69360436-69360458 AGGCCGGGGCCTCCAGTAAGTGG - Intronic
1077467660 11:2741232-2741254 AGGACAGGGCCTCCTGTGAGAGG + Intronic
1079106500 11:17575477-17575499 AGGAAGGGGGCTCCAGGAAGAGG + Intronic
1080458539 11:32435330-32435352 AAGCCGGGTCCTGCAGCAAGAGG + Exonic
1082918444 11:58465229-58465251 GGGCAAGGGCCCCCAGTAAGGGG + Intergenic
1084303332 11:68265307-68265329 AGGCAGGGGCAGCCAGTGAGGGG + Intronic
1084733789 11:71091609-71091631 AGGCCAGGGTCTCCAGGCAGAGG - Intronic
1085458849 11:76681076-76681098 AGACTGGGGCCTCCAGCAAGAGG + Intergenic
1089208600 11:116785506-116785528 ATGCTGGGGCTTCAAGTAAGTGG - Exonic
1089479487 11:118792475-118792497 AGGCCGGGCCCTCCACTAAAGGG + Intergenic
1089681397 11:120120944-120120966 AGGGTGGGGCCTCCTGGAAGTGG + Intronic
1091335556 11:134763027-134763049 AAGCCGGGGTCTCCAGAGAGAGG + Intergenic
1102997376 12:117360952-117360974 AGGCCGGGGGCTCCGGTCCGGGG - Intronic
1103951064 12:124551450-124551472 AGGCGGTGGCCTCCAGGAAGGGG + Intronic
1105213417 13:18271131-18271153 AGGCCAGGCCCTGCAGAAAGAGG - Intergenic
1108107531 13:47027851-47027873 AGTCGGGGGCCTGCAGTCAGGGG + Intergenic
1118710843 14:68518359-68518381 AGACCGGGGCCTGCAGTCACAGG - Intronic
1119327810 14:73771941-73771963 TGGCAGGGGCCTGAAGTAAGAGG + Intronic
1119551087 14:75514627-75514649 GGGCGGAGCCCTCCAGTAAGGGG - Intergenic
1119567647 14:75642127-75642149 AGGCCGGGGGCTCCAGAAAGAGG - Intronic
1121169643 14:91842810-91842832 AGGACTGTGGCTCCAGTAAGTGG - Intronic
1129359847 15:75017957-75017979 AGGCTGGGGCGTCTGGTAAGAGG + Exonic
1132524377 16:407094-407116 AGGTCGAGGGCTCCAGTAGGTGG - Intronic
1138660897 16:58516257-58516279 AGGCCGGGGCCTGCAGCTCGTGG - Exonic
1141140812 16:81495739-81495761 AGGCAGGGGCTTCCAGGAGGAGG - Intronic
1141994894 16:87630154-87630176 AGGCCAGTGCCTCCAGTGTGGGG - Intronic
1142118719 16:88375335-88375357 AGCCCAAGGCCACCAGTAAGAGG + Intergenic
1144232834 17:13226161-13226183 TGGCCGGTGCCTCCAGAAAGAGG + Intergenic
1148680875 17:49472846-49472868 AGGCCAGGGCCAACAGGAAGAGG + Intronic
1148782926 17:50131667-50131689 AGTCCGAGGCCTCCGGGAAGTGG + Intergenic
1148812817 17:50305128-50305150 AGCCCGGGGCCTGCCGCAAGGGG - Intergenic
1151456991 17:74232323-74232345 AGGCCCTGGCCTCCAGAAAGGGG + Intronic
1151758941 17:76089919-76089941 CCGCCGTGGCCTCCAGTAATAGG - Intronic
1152376539 17:79921512-79921534 AGGCTGGGGCCTCCAGTGAGTGG - Intergenic
1157308847 18:46536885-46536907 AGGCTGGGCCCTCCAGGCAGTGG - Intronic
1160222153 18:76985325-76985347 AGGCCGGGGCCTCCGGGGACCGG - Intronic
1160497665 18:79384612-79384634 ACTCCGGGGCCTCCAGTGAGTGG - Intergenic
1160660668 19:296992-297014 ATGCCAGGGCCTCCAGAAACAGG - Intergenic
1160703718 19:519544-519566 AGGCCGGGGCTCCCAGGAAGCGG + Exonic
1160765346 19:805173-805195 TGGCCGCGGCCTTCGGTAAGAGG + Exonic
1161046427 19:2137213-2137235 ACGCTGGGGCCACCAGCAAGTGG + Intronic
1161933281 19:7355549-7355571 AGGATGGGGCTGCCAGTAAGAGG - Intronic
1162520844 19:11178545-11178567 AGGCCGGGGGCACCGGTAAGTGG - Exonic
1164591000 19:29506825-29506847 AGTCTGGGCCCTCCAGGAAGGGG + Intergenic
1165741870 19:38209700-38209722 AGGACGGGGCCTCGAGGAGGAGG - Intergenic
1166268598 19:41700228-41700250 AGGGTGGGGCCTCCAGGGAGGGG + Intronic
1167009387 19:46796703-46796725 AGGCCTGGGGCTCCAGGAAGGGG + Intergenic
925706159 2:6686106-6686128 AGGCCAGGGCCCCCAGATAGGGG - Intergenic
926247140 2:11130011-11130033 GGGCGGGGGCCTACAGGAAGTGG + Intergenic
926325006 2:11777972-11777994 AGGCTGTGGCCTCCAGCGAGGGG - Intronic
926325655 2:11783500-11783522 AGGCTGTGGCCTCCAGCGAGGGG + Intronic
927930469 2:27040443-27040465 AGGCCAGGGCCTCAAGCAAGAGG - Exonic
928361580 2:30666210-30666232 AGGCTGGGGCTTCCAAAAAGAGG + Intergenic
932613681 2:73218518-73218540 AGGCTGGGGCCTCCAGTACCAGG - Intronic
932660051 2:73643931-73643953 AGAGCGGGGCCTCCAGTACAGGG + Intergenic
934781472 2:96972123-96972145 GGGCGGGGGGCTCCAGTCAGTGG + Exonic
940619775 2:156097088-156097110 ATGCCGGGGCCTCCAGTGAATGG + Intergenic
948901146 2:240957511-240957533 GGGCCGGGGCGTCCAGGCAGCGG + Intronic
1173210674 20:41029201-41029223 AGGCCGGAGCCCCCGGTGAGGGG + Intronic
1173252896 20:41374037-41374059 AGGCCAGCCCCTCCAGCAAGGGG - Intergenic
1178578292 21:33814774-33814796 AGGGCGGTGCCACCAGTCAGGGG + Intronic
1180816249 22:18791531-18791553 AGGCCAGGCCCTGCAGAAAGAGG - Intergenic
1181202438 22:21225863-21225885 AGGCCAGGCCCTGCAGAAAGAGG - Intronic
1181323042 22:22023296-22023318 TGGCCTGTGCCTCCAGTCAGTGG + Intergenic
1181637497 22:24181238-24181260 AGGCCGGAGCCTCCAGCCACAGG - Exonic
1181666966 22:24405079-24405101 GGGCCGGGGCCACCAGTGTGTGG - Intronic
1184370897 22:44081301-44081323 AGGCCGGGTCCTCCTGTTGGGGG + Intronic
1184607772 22:45584021-45584043 AGGCAGGGGCCCCCAGGAGGTGG + Intronic
1203224475 22_KI270731v1_random:69550-69572 AGGCCAGGCCCTGCAGAAAGAGG + Intergenic
1203266352 22_KI270734v1_random:17242-17264 AGGCCAGGCCCTGCAGAAAGAGG - Intergenic
950493369 3:13319465-13319487 GGGCCCGGGCCTCCAGCAGGTGG - Intronic
950570787 3:13798727-13798749 ATGCTGGGGCCTGCAGGAAGTGG + Intergenic
954031738 3:47824864-47824886 AGCCCTGGGCCTTCAGTAGGCGG - Intronic
959468484 3:106720295-106720317 AGGACGGGGCCTCCAAAAAGGGG - Intergenic
960666279 3:120112088-120112110 AGGCTGGGGCCTGCAGGTAGAGG - Intergenic
961141773 3:124562254-124562276 AGGCTGATGGCTCCAGTAAGGGG + Intronic
961664792 3:128488541-128488563 CGGCCGGTGGCTCCAGAAAGGGG + Intronic
961779724 3:129314635-129314657 AGCCAGGGGCCTTCAGCAAGGGG - Intergenic
962880451 3:139571912-139571934 AGACTGGAGCCTCCAGTGAGAGG - Intronic
966465328 3:180225313-180225335 AGGCAGTTGCCTCCAGTATGTGG - Intergenic
967367073 3:188699332-188699354 AGGCCTGGGCATCCAGTCAGGGG - Intronic
967972052 3:195006280-195006302 AGCCCGGGGCTGCCAGTCAGCGG - Intergenic
968312844 3:197698317-197698339 AAGCCGTGGCCTCCTGGAAGTGG - Intronic
968570800 4:1339565-1339587 AGGCCAGGGCCAACAGGAAGTGG - Exonic
969868235 4:10089111-10089133 GGGCTGGTGCCTCCAGGAAGAGG - Intronic
973754936 4:54064875-54064897 GGGTCGCGGCCTCCAGTCAGCGG - Intronic
976086645 4:81413674-81413696 TGGCAGGGGCCTCCATTCAGAGG + Intergenic
1001058366 5:168467787-168467809 TGGAGGGGGCCTCCAGAAAGGGG - Intronic
1001463873 5:171944504-171944526 AGGGCGGAGCCTGCAGTGAGCGG + Intronic
1002192153 5:177483899-177483921 AGCCCAGGGCCTCCAGGAAGCGG + Exonic
1002968939 6:1994703-1994725 AGCCTGGGGCCTCCAGAAGGAGG + Intronic
1003596881 6:7481807-7481829 AGGACGGGTCCACCAGTGAGGGG - Intergenic
1006595876 6:35192282-35192304 AGGCCGGGAGCTGCAGCAAGGGG - Intergenic
1013447004 6:110239748-110239770 AGGCCTGGGCATCCTGTGAGAGG + Intronic
1016960558 6:149668913-149668935 GGGGCGGGGGCACCAGTAAGTGG - Intronic
1018950673 6:168376937-168376959 AGGTGGGGCCCTCCAGGAAGTGG - Intergenic
1026509359 7:71015696-71015718 AGTTCGGTGCCTCCAGGAAGCGG + Intergenic
1033351985 7:140569401-140569423 AGGCCAGGGCCTGCAGTACTGGG + Intronic
1035026778 7:155831451-155831473 AGGCCGGGGTCTCCTGACAGCGG - Intergenic
1035266856 7:157693810-157693832 AGGCTGGGGTCTCCAGCAGGCGG + Intronic
1035682101 8:1495622-1495644 AGCCAGGGTCCTCCAGGAAGAGG - Intergenic
1036141367 8:6212271-6212293 AGGCAGGAGCCTCCAAGAAGAGG + Intergenic
1043087478 8:75853103-75853125 AGGCTGGAGCTTGCAGTAAGCGG - Intergenic
1045482085 8:102600815-102600837 AGGCCGGGCCCTCCAGGAGGGGG - Intergenic
1049642678 8:143722504-143722526 GGGCCGGGGCCCCCAGCTAGTGG - Intergenic
1055574668 9:77648757-77648779 GGGCCGGGGCGTCCGGGAAGCGG - Intergenic
1058045463 9:100352764-100352786 CGGCCGGGTCCTCAGGTAAGCGG - Exonic
1061627560 9:131850094-131850116 AGGCCTGGGCACCCTGTAAGGGG - Intergenic
1061807407 9:133144143-133144165 AGACCTGGGCCTGCAGTAACAGG + Intronic
1061913684 9:133738200-133738222 AGGCTGGGGCCTCCCCTATGTGG - Intronic
1062399452 9:136366038-136366060 AGGCCGTGGCCTCCAAGCAGAGG - Intronic
1062583940 9:137240654-137240676 AGCCCGGGGCCTCCAGGCCGAGG - Intergenic
1203778283 EBV:86179-86201 GGGCCGGGGCCTCCATCCAGTGG + Intergenic
1190308777 X:49101889-49101911 AGGCCGGGGCCTCTCGTTGGTGG + Intergenic
1192432356 X:71121033-71121055 CGGCCAGGGCCTGCAGGAAGTGG + Exonic
1200241024 X:154493926-154493948 AGGCAGGGGCCTCTAGAAACAGG + Intergenic