ID: 1069550441

View in Genome Browser
Species Human (GRCh38)
Location 10:69360436-69360458
Sequence AGGCCGGGGCCTCCAGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550441_1069550448 -5 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT No data
Right 1069550448 10:69360454-69360476 GGCCTTGTAGGGTATGGCTGTGG No data
1069550441_1069550453 16 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT No data
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550441_1069550455 30 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT No data
Right 1069550455 10:69360489-69360511 GGAATGAGGTCTCACAGCTCTGG No data
1069550441_1069550451 5 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT No data
Right 1069550451 10:69360464-69360486 GGTATGGCTGTGGCCTTGTCGGG No data
1069550441_1069550452 9 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT No data
Right 1069550452 10:69360468-69360490 TGGCTGTGGCCTTGTCGGGCAGG No data
1069550441_1069550450 4 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT No data
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550441 Original CRISPR AGGCCGGGGCCTCCAGTAAG TGG (reversed) Intronic