ID: 1069550445

View in Genome Browser
Species Human (GRCh38)
Location 10:69360450-69360472
Sequence AGCCATACCCTACAAGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 62}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550445_1069550457 25 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1069550457 10:69360498-69360520 TCTCACAGCTCTGGGCTATTTGG No data
1069550445_1069550451 -9 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1069550451 10:69360464-69360486 GGTATGGCTGTGGCCTTGTCGGG No data
1069550445_1069550453 2 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550445_1069550452 -5 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1069550452 10:69360468-69360490 TGGCTGTGGCCTTGTCGGGCAGG No data
1069550445_1069550455 16 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1069550455 10:69360489-69360511 GGAATGAGGTCTCACAGCTCTGG No data
1069550445_1069550460 28 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1069550460 10:69360501-69360523 CACAGCTCTGGGCTATTTGGGGG No data
1069550445_1069550450 -10 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data
1069550445_1069550458 26 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1069550458 10:69360499-69360521 CTCACAGCTCTGGGCTATTTGGG No data
1069550445_1069550459 27 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1069550459 10:69360500-69360522 TCACAGCTCTGGGCTATTTGGGG No data
1069550445_1069550456 17 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1069550456 10:69360490-69360512 GAATGAGGTCTCACAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550445 Original CRISPR AGCCATACCCTACAAGGCCG GGG (reversed) Intronic
905270249 1:36782944-36782966 GGCCATTCCCCACAAGGCAGGGG + Intergenic
920366085 1:205449106-205449128 AGCCATCCCTGACAAGGCTGTGG + Intronic
1069550445 10:69360450-69360472 AGCCATACCCTACAAGGCCGGGG - Intronic
1071236276 10:83653337-83653359 GGACAAACCCTACAAGTCCGAGG - Intergenic
1071444971 10:85736989-85737011 ACTCATACCCTCCAAGGCCCAGG - Intronic
1077144533 11:1038809-1038831 AGCCATAACCTTCAAGGTCAGGG - Intergenic
1079819307 11:25105345-25105367 AGCTATACCCTACAGAGCCATGG - Intergenic
1086936555 11:92751581-92751603 AGCCATACCCCACAACCCAGTGG + Intronic
1117292562 14:54347741-54347763 AGCTATATCCTAGAAGGCCTTGG + Intergenic
1134693365 16:16205468-16205490 GGCCAGACCCTTCAAGGCCAAGG + Intronic
1134978487 16:18589232-18589254 GGCCAGACCCTTCAAGGCCAAGG - Intergenic
1136030238 16:27497408-27497430 TGCCATACCCTACAAGGCTTTGG - Intronic
1136612800 16:31377540-31377562 AGGCACACCCCACAAGGGCGAGG - Intronic
1137756554 16:50906725-50906747 AGCAATGCCAGACAAGGCCGGGG + Intergenic
1138965589 16:62080386-62080408 AGCCATACCAGAGGAGGCCGAGG + Intergenic
1142261371 16:89044003-89044025 ATGCTTACCCTACAAGGCCCAGG + Intergenic
1142708528 17:1710719-1710741 CGCCACACCCTGCAAGGCAGAGG + Intergenic
1157812176 18:50705088-50705110 ACCCATACCCCACACGGCAGAGG + Intronic
1160580960 18:79884420-79884442 AGCCAGTCCCTGCCAGGCCGGGG - Intronic
930404902 2:50942476-50942498 ATCCATACCCTACAGAGCCATGG + Intronic
938625976 2:133110088-133110110 AGACATATCCTGCAAGGCTGTGG - Intronic
939184374 2:138843011-138843033 AGCCATATCCTACATTGCTGGGG + Intergenic
940231858 2:151463152-151463174 CCCCATACCCTACAAGTCGGAGG + Exonic
940547296 2:155103480-155103502 AGTCATATCCTACATGGCAGTGG + Intergenic
941015227 2:160348457-160348479 AGACATACCCTAGAAGGCAAAGG + Intronic
947916859 2:233838346-233838368 CACCATTCTCTACAAGGCCGAGG + Intronic
1174127350 20:48316685-48316707 AGACAAACCCTTCAAGGCTGTGG + Intergenic
1175495412 20:59410955-59410977 AGCCATTCTCTACATGGCCTTGG - Intergenic
1178325742 21:31644041-31644063 AAGCATACCCTAGAAGGCCTGGG + Intergenic
953251251 3:41247268-41247290 AGCCAGACTCTACCAGGCCTGGG + Intronic
953332057 3:42061935-42061957 AGCAATAGCCTAGAAGGGCGTGG - Intronic
953751270 3:45610304-45610326 ATCCATACCCTACACTGACGTGG + Intronic
965165745 3:165193438-165193460 AGCCATTCCCTGCAATGACGGGG + Intronic
966638173 3:182158559-182158581 AGCCAGTGCCTACAAGGCCATGG + Intergenic
966733758 3:183172447-183172469 GGTCATACCCTTCAAGGCCCAGG - Intergenic
968334395 3:197900852-197900874 GGCCCTCCCCTACAAGGCAGTGG - Intronic
970205259 4:13649251-13649273 AGCCATATCCTTCAAGGCTCAGG + Intergenic
973107821 4:46361745-46361767 GGCTATACCCTACAAGGCCATGG + Intronic
974756138 4:66210542-66210564 AGCCAGCCCCTACAATGCAGAGG - Intergenic
976127975 4:81854093-81854115 AGCTATACCCTGCAAAGCCGTGG - Intronic
980679375 4:136137571-136137593 AGTCATAGCCTACAAGGACTGGG + Intergenic
981547603 4:145910322-145910344 AGCCAGACCTTCCATGGCCGAGG + Intronic
982093156 4:151897527-151897549 ACCCATACCATAGAAGGCCTAGG + Intergenic
985932840 5:3072667-3072689 ACACATACCCTACAACGTCGTGG - Intergenic
988341746 5:29981456-29981478 AGGCATGCCCCACAAGGCCTGGG + Intergenic
989045864 5:37272784-37272806 TGGCATACCCTGCAAGGGCGTGG + Intergenic
997526865 5:134559337-134559359 CGGCATACCCTTCAAGGCTGCGG - Intronic
997894650 5:137705267-137705289 AGCCAGACTCTACCAGGCCCTGG - Intronic
999435285 5:151558904-151558926 AGCCATGGCCTAAGAGGCCGTGG + Intronic
1006641659 6:35492484-35492506 AGCCACACCCTGCCAGGCTGGGG + Intronic
1007231552 6:40351623-40351645 ATCCATACCCTACAAGGCATGGG - Intergenic
1008544721 6:52574983-52575005 AGCCACACCCTCCAAGGCTGGGG + Intronic
1013170061 6:107628830-107628852 AGCCCTACCCTGGAATGCCGTGG - Intronic
1013253537 6:108359656-108359678 AGCCACACCATACAAGTCCAAGG - Intronic
1022440739 7:30430850-30430872 AGCCATACCCCACAAGGGCTAGG + Intronic
1035182022 7:157096482-157096504 TGCCATCCCCTTCCAGGCCGTGG - Intergenic
1035621840 8:1041347-1041369 AGCTAAAACCTACATGGCCGAGG + Intergenic
1042162647 8:65912648-65912670 GGACTTACCCTACAAGGCAGTGG - Intergenic
1042297907 8:67242464-67242486 GGCCATTCCCTTCAAGGCAGTGG - Intronic
1042314023 8:67406612-67406634 AGGCATACCCTTCATGGCCCTGG - Intergenic
1048499771 8:134964962-134964984 AGCCATACCCTAGAGGGGTGGGG + Intergenic
1062053019 9:134457133-134457155 AGCCATACCCTACAGGACACAGG - Intergenic
1187579353 X:20591940-20591962 TGCCATTCCCTTCAAGGCAGTGG + Intergenic
1190776846 X:53559464-53559486 AGCCTTCCCCTACAAAGCCGGGG - Exonic
1192190478 X:68988463-68988485 AGCCCTGCCTTACAAGGCCTGGG - Intergenic
1196552481 X:117045577-117045599 AGTCATTCCCTTCAAGGCAGTGG - Intergenic
1196930132 X:120673832-120673854 GGCCATACCATGCAAGGCCTTGG + Intergenic
1199997868 X:153037903-153037925 GGCAATACCCTACAAGGATGAGG + Intergenic
1200928946 Y:8679675-8679697 AGAGATACCCTGCAAGGCCAAGG - Intergenic
1201729914 Y:17192398-17192420 AGCCCTGCCCTACAGGGCAGCGG + Intergenic