ID: 1069550447

View in Genome Browser
Species Human (GRCh38)
Location 10:69360452-69360474
Sequence ACAGCCATACCCTACAAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550447_1069550457 23 Left 1069550447 10:69360452-69360474 CCGGCCTTGTAGGGTATGGCTGT No data
Right 1069550457 10:69360498-69360520 TCTCACAGCTCTGGGCTATTTGG No data
1069550447_1069550460 26 Left 1069550447 10:69360452-69360474 CCGGCCTTGTAGGGTATGGCTGT No data
Right 1069550460 10:69360501-69360523 CACAGCTCTGGGCTATTTGGGGG No data
1069550447_1069550455 14 Left 1069550447 10:69360452-69360474 CCGGCCTTGTAGGGTATGGCTGT No data
Right 1069550455 10:69360489-69360511 GGAATGAGGTCTCACAGCTCTGG No data
1069550447_1069550452 -7 Left 1069550447 10:69360452-69360474 CCGGCCTTGTAGGGTATGGCTGT No data
Right 1069550452 10:69360468-69360490 TGGCTGTGGCCTTGTCGGGCAGG No data
1069550447_1069550456 15 Left 1069550447 10:69360452-69360474 CCGGCCTTGTAGGGTATGGCTGT No data
Right 1069550456 10:69360490-69360512 GAATGAGGTCTCACAGCTCTGGG No data
1069550447_1069550458 24 Left 1069550447 10:69360452-69360474 CCGGCCTTGTAGGGTATGGCTGT No data
Right 1069550458 10:69360499-69360521 CTCACAGCTCTGGGCTATTTGGG No data
1069550447_1069550453 0 Left 1069550447 10:69360452-69360474 CCGGCCTTGTAGGGTATGGCTGT No data
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550447_1069550459 25 Left 1069550447 10:69360452-69360474 CCGGCCTTGTAGGGTATGGCTGT No data
Right 1069550459 10:69360500-69360522 TCACAGCTCTGGGCTATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550447 Original CRISPR ACAGCCATACCCTACAAGGC CGG (reversed) Intronic