ID: 1069550450

View in Genome Browser
Species Human (GRCh38)
Location 10:69360463-69360485
Sequence GGGTATGGCTGTGGCCTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550445_1069550450 -10 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data
1069550441_1069550450 4 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT 0: 1
1: 0
2: 3
3: 17
4: 111
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data
1069550438_1069550450 10 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data
1069550434_1069550450 30 Left 1069550434 10:69360410-69360432 CCTTTTCTCCTGGTCATTGGCCT 0: 1
1: 0
2: 3
3: 33
4: 316
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data
1069550440_1069550450 5 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC 0: 1
1: 0
2: 1
3: 11
4: 80
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data
1069550435_1069550450 22 Left 1069550435 10:69360418-69360440 CCTGGTCATTGGCCTCACCCACT 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550450 Original CRISPR GGGTATGGCTGTGGCCTTGT CGG Intronic
No off target data available for this crispr