ID: 1069550453

View in Genome Browser
Species Human (GRCh38)
Location 10:69360475-69360497
Sequence GGCCTTGTCGGGCAGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550441_1069550453 16 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT No data
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550449_1069550453 -4 Left 1069550449 10:69360456-69360478 CCTTGTAGGGTATGGCTGTGGCC No data
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550440_1069550453 17 Left 1069550440 10:69360435-69360457 CCCACTTACTGGAGGCCCCGGCC No data
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550446_1069550453 1 Left 1069550446 10:69360451-69360473 CCCGGCCTTGTAGGGTATGGCTG No data
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550438_1069550453 22 Left 1069550438 10:69360430-69360452 CCTCACCCACTTACTGGAGGCCC No data
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550447_1069550453 0 Left 1069550447 10:69360452-69360474 CCGGCCTTGTAGGGTATGGCTGT No data
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data
1069550445_1069550453 2 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT No data
Right 1069550453 10:69360475-69360497 GGCCTTGTCGGGCAGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550453 Original CRISPR GGCCTTGTCGGGCAGGAATG AGG Intronic