ID: 1069550455

View in Genome Browser
Species Human (GRCh38)
Location 10:69360489-69360511
Sequence GGAATGAGGTCTCACAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550446_1069550455 15 Left 1069550446 10:69360451-69360473 CCCGGCCTTGTAGGGTATGGCTG 0: 1
1: 0
2: 1
3: 19
4: 304
Right 1069550455 10:69360489-69360511 GGAATGAGGTCTCACAGCTCTGG No data
1069550449_1069550455 10 Left 1069550449 10:69360456-69360478 CCTTGTAGGGTATGGCTGTGGCC No data
Right 1069550455 10:69360489-69360511 GGAATGAGGTCTCACAGCTCTGG No data
1069550445_1069550455 16 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT No data
Right 1069550455 10:69360489-69360511 GGAATGAGGTCTCACAGCTCTGG No data
1069550447_1069550455 14 Left 1069550447 10:69360452-69360474 CCGGCCTTGTAGGGTATGGCTGT No data
Right 1069550455 10:69360489-69360511 GGAATGAGGTCTCACAGCTCTGG No data
1069550441_1069550455 30 Left 1069550441 10:69360436-69360458 CCACTTACTGGAGGCCCCGGCCT No data
Right 1069550455 10:69360489-69360511 GGAATGAGGTCTCACAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550455 Original CRISPR GGAATGAGGTCTCACAGCTC TGG Intronic