ID: 1069550460

View in Genome Browser
Species Human (GRCh38)
Location 10:69360501-69360523
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550449_1069550460 22 Left 1069550449 10:69360456-69360478 CCTTGTAGGGTATGGCTGTGGCC No data
Right 1069550460 10:69360501-69360523 CACAGCTCTGGGCTATTTGGGGG No data
1069550447_1069550460 26 Left 1069550447 10:69360452-69360474 CCGGCCTTGTAGGGTATGGCTGT No data
Right 1069550460 10:69360501-69360523 CACAGCTCTGGGCTATTTGGGGG No data
1069550446_1069550460 27 Left 1069550446 10:69360451-69360473 CCCGGCCTTGTAGGGTATGGCTG No data
Right 1069550460 10:69360501-69360523 CACAGCTCTGGGCTATTTGGGGG No data
1069550445_1069550460 28 Left 1069550445 10:69360450-69360472 CCCCGGCCTTGTAGGGTATGGCT No data
Right 1069550460 10:69360501-69360523 CACAGCTCTGGGCTATTTGGGGG No data
1069550454_1069550460 1 Left 1069550454 10:69360477-69360499 CCTTGTCGGGCAGGAATGAGGTC No data
Right 1069550460 10:69360501-69360523 CACAGCTCTGGGCTATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type