ID: 1069550881

View in Genome Browser
Species Human (GRCh38)
Location 10:69363175-69363197
Sequence CTGTGTCACTGCCATGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069550876_1069550881 17 Left 1069550876 10:69363135-69363157 CCTAAGACAGCCTTCTTCTGGGT 0: 1
1: 0
2: 1
3: 18
4: 216
Right 1069550881 10:69363175-69363197 CTGTGTCACTGCCATGTGTAAGG No data
1069550877_1069550881 7 Left 1069550877 10:69363145-69363167 CCTTCTTCTGGGTTCCAAAAAGC No data
Right 1069550881 10:69363175-69363197 CTGTGTCACTGCCATGTGTAAGG No data
1069550879_1069550881 -7 Left 1069550879 10:69363159-69363181 CCAAAAAGCTCCATGGCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 174
Right 1069550881 10:69363175-69363197 CTGTGTCACTGCCATGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069550881 Original CRISPR CTGTGTCACTGCCATGTGTA AGG Intronic
No off target data available for this crispr