ID: 1069554008

View in Genome Browser
Species Human (GRCh38)
Location 10:69384857-69384879
Sequence CGTGAAGCCCAGAGGCATCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069554008_1069554010 8 Left 1069554008 10:69384857-69384879 CCAGGATGCCTCTGGGCTTCACG 0: 1
1: 0
2: 0
3: 13
4: 189
Right 1069554010 10:69384888-69384910 TCCCTGCCAGCAGACGAGTCTGG 0: 1
1: 0
2: 1
3: 9
4: 152
1069554008_1069554014 14 Left 1069554008 10:69384857-69384879 CCAGGATGCCTCTGGGCTTCACG 0: 1
1: 0
2: 0
3: 13
4: 189
Right 1069554014 10:69384894-69384916 CCAGCAGACGAGTCTGGACGCGG 0: 1
1: 0
2: 0
3: 10
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069554008 Original CRISPR CGTGAAGCCCAGAGGCATCC TGG (reversed) Exonic
900413163 1:2522430-2522452 CGAGAAGCCCTGTGGCTTCCAGG + Intronic
900647982 1:3717651-3717673 CCTGAAGCCTAGAGGCCTGCTGG + Intronic
901858112 1:12057213-12057235 CGCCAGGCCCAGAGGAATCCAGG + Intergenic
902735317 1:18396914-18396936 GGTGAAGTCCAGAGGAAACCAGG - Intergenic
903741375 1:25560484-25560506 TTTGGAGCCCAGAGGCCTCCCGG - Intronic
904160380 1:28518444-28518466 CGTGAAGCCCGGAGGCAGGAAGG + Intronic
904708669 1:32411863-32411885 GCTGAAGCCCAGAGGCATTGTGG + Intergenic
905467485 1:38166443-38166465 TGTCTTGCCCAGAGGCATCCTGG + Intergenic
905796429 1:40818936-40818958 CTTCAAACCCAGAAGCATCCAGG - Intronic
913230082 1:116734458-116734480 TCTGAGGCCCAGAGACATCCAGG + Intergenic
914714076 1:150239735-150239757 CGTGAAGTCCTGTGGCTTCCTGG + Intergenic
916502858 1:165401415-165401437 AGGGAAGCCAAGAGGCATCAGGG + Intronic
919787647 1:201270010-201270032 CCTGAAGTCCACAGGCAGCCAGG - Intergenic
920658063 1:207891074-207891096 TCAGAAGCCCAGAGTCATCCAGG - Intronic
921498292 1:215868049-215868071 CGACCATCCCAGAGGCATCCAGG + Intronic
922467675 1:225855491-225855513 CCCAGAGCCCAGAGGCATCCTGG + Intronic
922705757 1:227789240-227789262 CGTGGATCCCAGATGCAACCAGG - Intergenic
923459539 1:234196474-234196496 AGTGAAGCCAAGAGCCCTCCTGG + Intronic
924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG + Intergenic
924735937 1:246755857-246755879 CTTGAAGCCCGGAGGCCTGCTGG - Intronic
1063299262 10:4836893-4836915 CCTGAAGCTCAGGGGCAGCCTGG + Intronic
1065677366 10:28192040-28192062 CTTGAACCCCAGAGGCAGCCTGG + Intronic
1065993154 10:31032047-31032069 GGCGAAGCCCACAGGCATGCGGG - Intergenic
1066106701 10:32163137-32163159 GGTGAAACCCAAAGGCAGCCTGG + Intergenic
1067663570 10:48254925-48254947 AGAGGAGCCCAGAGGCATCTTGG - Intronic
1068804616 10:61181297-61181319 CGTTAAGCTCAGAGGCATTCAGG + Intergenic
1069554008 10:69384857-69384879 CGTGAAGCCCAGAGGCATCCTGG - Exonic
1077077695 11:708853-708875 CCTGAAGTCCAGAGGGAGCCCGG - Intronic
1077361536 11:2142834-2142856 GGTGTAGCCCAGAGGGACCCGGG + Intronic
1077373674 11:2195301-2195323 TGGGGAGCCCAGAGGCATCTGGG - Intergenic
1081869477 11:46376812-46376834 CTGGAAGCCCAGAGCCATCCAGG + Intronic
1083745784 11:64735781-64735803 CTTGTAGGACAGAGGCATCCTGG - Intronic
1090249439 11:125241108-125241130 CGTGAAGCCCATGGTCAGCCAGG - Intronic
1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG + Exonic
1093300543 12:17448799-17448821 CATGACACCCAGAGGCATCTTGG + Intergenic
1095927219 12:47591209-47591231 CCTGAGGCTCAGAGGCATCAGGG - Intergenic
1102392423 12:112560087-112560109 CGTGAAGCCAAGAACCCTCCTGG + Intergenic
1102872251 12:116423135-116423157 CCTGATGACCAGAGGCACCCCGG - Intergenic
1104940829 12:132393972-132393994 AGTGAAGCCAAGAAGCCTCCCGG + Intergenic
1107426367 13:40297100-40297122 CCTGAAGCCTTGAGGGATCCAGG + Intergenic
1107565905 13:41604144-41604166 CCTGAAGCTCAGAGCCAACCTGG + Intronic
1108593921 13:51934540-51934562 CGTGAGGCCAAGAGGCAGGCAGG + Exonic
1110342526 13:74409556-74409578 CAAGAAGCCCAGAGGCAACAGGG + Intergenic
1111790791 13:92852072-92852094 CAGGAAGTCCAGAGGCATCAGGG + Intronic
1113575117 13:111389906-111389928 CGTGGAGCACAGAGGCCTGCGGG + Intergenic
1116870018 14:50061627-50061649 GGTGATGAGCAGAGGCATCCAGG - Intergenic
1121717782 14:96088616-96088638 CGAGAAGCCCAGAGCCATGGCGG + Exonic
1121859320 14:97301723-97301745 CATGAGTCCCACAGGCATCCTGG - Intergenic
1202902299 14_GL000194v1_random:50824-50846 CCAGGAGCCCAGAGGCTTCCTGG + Intergenic
1124562872 15:30791714-30791736 GGTGGAGCCCAGAGGCAGTCCGG - Intergenic
1124855572 15:33384313-33384335 AATGCAGGCCAGAGGCATCCGGG + Intronic
1127885900 15:63200747-63200769 CCTGAGGCCTAGAGGCATCGGGG + Intronic
1130193788 15:81760581-81760603 CTTGGAGCCCACAGGCATCCTGG - Intergenic
1130866866 15:87940601-87940623 GGTAAACCCCAGAGGCATGCCGG - Exonic
1132664301 16:1074547-1074569 CGAGGAGCCCAGCGGCCTCCTGG + Intergenic
1133025953 16:2989050-2989072 CCTGAAGCTCAGATGCATCAGGG - Intergenic
1133052257 16:3123963-3123985 CGAGAAGCCCCGAGGAAGCCAGG - Intergenic
1135995605 16:27245448-27245470 CGTGAAGCGCACAGAAATCCTGG + Intronic
1136500007 16:30665334-30665356 CGGGAGGCCCGGAGGCAGCCCGG - Exonic
1138132516 16:54493028-54493050 CAAGAAGCCCAGAGGTTTCCAGG + Intergenic
1140377363 16:74455268-74455290 GGTGTGGCCCAGAGGCATCTGGG + Intronic
1141087939 16:81110195-81110217 CCTGAGCCCCAGAGGCACCCTGG - Intergenic
1141232226 16:82179407-82179429 CCTGATGCCCAGAGGCAGACAGG - Intergenic
1142606984 17:1087465-1087487 CGCCAAGGCCAGAGGCATTCAGG + Intronic
1144507309 17:15843377-15843399 CGAGAAGCCCAGAGAGATGCAGG - Intergenic
1144739055 17:17571021-17571043 CCTGAAGCCCTGAGGAGTCCAGG + Intronic
1145171436 17:20660982-20661004 CGAGAAGCCCAGAGAGATGCAGG - Intergenic
1147540062 17:41349950-41349972 GGAGAAGCCCAGAGGCATGAAGG + Intronic
1147945559 17:44078345-44078367 GGTGAAGCCCAGAGGGATGGGGG + Exonic
1148073061 17:44919889-44919911 GGTAAAGCCCAGATGCCTCCTGG + Intergenic
1148842424 17:50507865-50507887 CCTGGAGCCCTGAGGCATTCTGG - Intergenic
1151805995 17:76405760-76405782 CGTCACGCCCACAGGCCTCCTGG + Intronic
1153740855 18:8126125-8126147 AGTGTAGCCCACAGGCACCCAGG + Intronic
1155043965 18:22087862-22087884 CGTGCAGCCCAGAGCCATTGTGG + Intergenic
1156973349 18:43184900-43184922 CGTGAAGCACTGAGGCTGCCTGG - Intergenic
1157684433 18:49631093-49631115 CGTAAAGCCCAGAGGCCTTCGGG + Intergenic
1159468084 18:68811795-68811817 CGTGAAGCACAGAGGACTGCAGG + Intronic
1160240711 18:77120373-77120395 TGTGACGCCCAGAGGCACTCAGG + Intronic
1160242548 18:77133439-77133461 CCTGCAGCCCAGAGACATCGTGG + Intronic
1161604415 19:5206717-5206739 CGGGAGGGGCAGAGGCATCCGGG + Exonic
1161981266 19:7631671-7631693 CCTGAGGGCCTGAGGCATCCTGG - Exonic
1162126981 19:8504950-8504972 CTTGAAGCCGGGAGGCAGCCTGG - Intergenic
1163290781 19:16377769-16377791 TGTGCAGCCCAGAGGCATGGAGG - Intronic
1164145265 19:22509134-22509156 CATGCAACCCAGAGGCATCCGGG + Intronic
1164399950 19:27895604-27895626 CCTGAAGCCCAGTGCCATCCTGG + Intergenic
1164560982 19:29292071-29292093 GGTGAAGCCAAGAGTCCTCCTGG - Intergenic
1164806263 19:31119406-31119428 CTTGAAGCCCAGCTGCATTCTGG - Intergenic
1165477613 19:36040207-36040229 CTTGGAGCCCAGAGACCTCCAGG - Intronic
1167230533 19:48280035-48280057 CGTGAAGCCCACTGGCAGCCAGG - Intronic
1168328398 19:55550506-55550528 ACTGAAGCGCAGAGGCATCCCGG - Intergenic
925107751 2:1307803-1307825 CCTGAAGCCCAGAGACCTTCCGG + Intronic
925273711 2:2634239-2634261 GGTAAAACCGAGAGGCATCCGGG - Intergenic
926003616 2:9354120-9354142 CGCGAACCCCATAGGCACCCTGG + Intronic
926887645 2:17612726-17612748 GTTAAAGCCCAGAGGCAACCTGG - Intronic
927146799 2:20171604-20171626 AGTAAAGCCCACAGGCATTCTGG - Intergenic
928183766 2:29090810-29090832 TGTGATGCCCAGAGGCACACAGG + Intergenic
929925386 2:46202933-46202955 CCAGAAGCCCAGAGTCCTCCAGG + Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933033176 2:77358313-77358335 AGCAAAGCCAAGAGGCATCCTGG + Intronic
934504369 2:94879584-94879606 CCAGGAGCCCAGAGGCTTCCTGG - Intergenic
936629001 2:114180027-114180049 CGTGAAGCCCAGAGACAATAAGG + Intergenic
937913446 2:127087468-127087490 CGTGGACCCCAGAGGAAGCCAGG + Intronic
940358902 2:152776178-152776200 GGTGAAGTCCAGAAGAATCCAGG - Intergenic
941017669 2:160375025-160375047 CGTGAAGACCTGAGCCTTCCAGG - Intronic
942249382 2:174034506-174034528 CCGGCATCCCAGAGGCATCCAGG - Intergenic
944875495 2:203960692-203960714 TGTCAAGCCCAGAGGCACCATGG - Exonic
947044183 2:225959749-225959771 GGTGAAGGCCAGAGTCATACTGG + Intergenic
947217169 2:227759987-227760009 AAAGAAGCCCAGAGGCATTCAGG - Intergenic
948107966 2:235430247-235430269 GGTGAAGCCCAGAACCCTCCTGG - Intergenic
948516856 2:238509555-238509577 CATGCAGCCCAGAAGCAGCCTGG - Intergenic
948624910 2:239262926-239262948 CGTGAAGCACAGAAGCTTCCAGG - Intronic
948857092 2:240735266-240735288 CCTCAACCCCAGAGGCACCCTGG + Intronic
1170614667 20:17939015-17939037 CCTGAAGCCCGCAGGAATCCTGG + Intergenic
1171343469 20:24448020-24448042 GGTGAAACCCAGAGGGTTCCTGG + Intergenic
1172445856 20:34993111-34993133 CCTGAACCCCAGTGCCATCCCGG + Exonic
1174116661 20:48230982-48231004 GGTGCAGCCCACAGGCAACCTGG - Intergenic
1175433986 20:58929506-58929528 GAAGAAGCCCAGAGTCATCCAGG + Intergenic
1176053429 20:63132795-63132817 AGTGAAGCCCACAGGCCCCCAGG + Intergenic
1176121409 20:63455981-63456003 CGTGAAGCAGAGGGGCCTCCCGG - Intronic
1176121439 20:63456050-63456072 CGTGAAGCAGAGGGGCCTCCCGG - Intronic
1176621667 21:9065591-9065613 CCAGGAGCCCAGAGGCTTCCTGG + Intergenic
1178757936 21:35370641-35370663 CCTGCAGCCCAGGGGCCTCCAGG - Intronic
1179621150 21:42617240-42617262 GGTGCAGCCCAGATGCCTCCTGG - Intergenic
1179910161 21:44443212-44443234 CTTGAAGCTCAGAGGCAGCAGGG + Intergenic
1180171933 21:46064044-46064066 CGTAAAGCCCAGCAGCATCTGGG + Intergenic
1181631514 22:24154079-24154101 CCTGCATCCCAGAGGCCTCCAGG - Intronic
1182440674 22:30362163-30362185 TGGGAAGCTCAGAGGCACCCAGG - Intronic
1182859136 22:33544165-33544187 GGTGAAGTCCAGAGGAAACCAGG - Intronic
1184214628 22:43058590-43058612 CTTGCAGCCCAGTGCCATCCCGG - Intronic
1184991781 22:48175198-48175220 ACTGAGTCCCAGAGGCATCCTGG + Intergenic
950088488 3:10278332-10278354 CGTGAAGCCCACAGACATGTTGG - Exonic
950678212 3:14567396-14567418 ACTGCAGCCCAGAGGCATGCAGG - Intergenic
952619710 3:35322962-35322984 CCTGAAGTCTTGAGGCATCCAGG + Intergenic
953526106 3:43691186-43691208 CGCGGCGCCCAGAGGCGTCCCGG + Intronic
954043869 3:47912157-47912179 CTTGAACCCCAGAGGGATCTTGG - Intronic
954128453 3:48546961-48546983 GGTGAAGTCCAGAGGAAACCAGG - Intronic
955893975 3:63679535-63679557 AGAAAAGGCCAGAGGCATCCCGG - Intergenic
959083201 3:101824130-101824152 CATAAATCCCAGAGGCATCATGG - Exonic
961630938 3:128297910-128297932 TGTGTGCCCCAGAGGCATCCAGG - Intronic
962103289 3:132365028-132365050 CGTGATGCTAAGAAGCATCCTGG + Intronic
964515391 3:157502073-157502095 AAGGAAGCCCAGAGACATCCAGG - Intronic
966176322 3:177142160-177142182 GGTGAAGCCAAGAAGCCTCCTGG - Intronic
967107251 3:186263983-186264005 TGTGATGCCCAGAAGCATCTTGG + Intronic
968517238 4:1020582-1020604 CTTCCAGCCCAGAGGCACCCAGG + Intronic
968649303 4:1754084-1754106 CCTGAAGTCCAGAGGACTCCAGG - Intergenic
968749306 4:2378992-2379014 CCTGGAGCCCAGAAACATCCAGG - Intronic
968958664 4:3731630-3731652 GGTGAAGTCCAGAGGCAAGCTGG + Intergenic
969594521 4:8141427-8141449 CCTGAAGCTCACAGGCACCCAGG + Intronic
969626208 4:8306940-8306962 AGTGCCGCCCAGAGGCATGCAGG + Exonic
969856864 4:10007029-10007051 GGTGAAGTCCAGAGGAAACCAGG - Intronic
982134239 4:152258655-152258677 AGTGAAGCCCAGAACCAGCCCGG + Intergenic
982147918 4:152417830-152417852 GGAGAAGCCCAGAGGCAGCAAGG - Intronic
982241619 4:153305549-153305571 TGTGAAGTCCAGAGGCATGGTGG + Intronic
983106831 4:163697046-163697068 AGTGAAGTCCAGAGGAAACCAGG + Intronic
985036779 4:185848225-185848247 CTTGAAGCCCAGAATCATCATGG - Intronic
985617998 5:936214-936236 CTCTAAGCCCAGAGGCAGCCTGG + Intergenic
986507958 5:8472363-8472385 AGTGAAGTCCAGAGGAAACCAGG - Intergenic
986720185 5:10555524-10555546 CCACAAGCCCCGAGGCATCCTGG + Intergenic
989231528 5:39092721-39092743 AGTGAAGTCCAGAGGAAACCAGG + Intergenic
991583329 5:68178854-68178876 TGTGGAGCCCACAGGCAGCCTGG + Intergenic
992641157 5:78769369-78769391 GGTGAAACCCAGAGGCATGGTGG + Intronic
995550749 5:113278638-113278660 TGTGAAGTCCAGAGACAACCAGG + Intronic
996581599 5:125037661-125037683 GGTGAGGCCCAGAGGAAACCAGG - Intergenic
998848585 5:146334114-146334136 CGAGACGCCCAGAGGGATTCAGG - Intronic
1001452279 5:171836070-171836092 GGTGACTCCCAGAGGCTTCCAGG + Intergenic
1001677409 5:173530127-173530149 CAAGAAGCCCAGAGGCAGGCAGG - Intergenic
1002343063 5:178529359-178529381 CGTGAAGCCCAGAGTCAGTGTGG + Intronic
1003837400 6:10086661-10086683 CCTCAATCCCAGAGGTATCCAGG + Intronic
1004777503 6:18864284-18864306 TGTGAAGCACAGAGGGATCTTGG + Intergenic
1006724317 6:36185885-36185907 AGTGAAGTCCAGAGGAAACCAGG + Intergenic
1007431168 6:41778144-41778166 GGTGTATCCCAGAGGGATCCGGG - Exonic
1009370460 6:62894180-62894202 GGTGAAGCCCAGAAGCCTCCTGG - Intergenic
1011492573 6:87907470-87907492 CGTGAAGCCCAGAGGCAGTGTGG - Intergenic
1013687277 6:112600342-112600364 GGGGAAGCCAAGAGGCTTCCTGG - Intergenic
1017827041 6:158089340-158089362 CCAGCACCCCAGAGGCATCCCGG - Intronic
1019436868 7:1026849-1026871 GATGAAGCCCAGAGGCTGCCTGG - Intronic
1019652656 7:2168816-2168838 CGTGGGGCCCAGAGGCCACCGGG + Intronic
1020279085 7:6641259-6641281 CATGAGCCCCAGAAGCATCCTGG - Intronic
1021604415 7:22395786-22395808 GGTGAAGCAAAGAGGCATACAGG - Intergenic
1029244767 7:99191059-99191081 CCTGAAACCTAGGGGCATCCTGG + Intronic
1033277190 7:139980816-139980838 AGTGAAGCCTAGAGGCAGACCGG - Intronic
1034746817 7:153530238-153530260 CTAGAAGCGCAGAGGCTTCCAGG + Intergenic
1036441934 8:8789395-8789417 TGTGAAGCCTACAGACATCCAGG + Intronic
1036780565 8:11644088-11644110 GGGGAAGCCCCGAGGCCTCCTGG - Intergenic
1037181996 8:16018448-16018470 TGTGAATTCCAGAGGCTTCCTGG - Intergenic
1037715976 8:21400602-21400624 GGTGAAGCCCAGAACCCTCCCGG - Intergenic
1040294542 8:46142407-46142429 CTTCAATCCCAGAAGCATCCAGG - Intergenic
1044738836 8:95304947-95304969 AGGGAAGCCCAAAGGCCTCCAGG - Intergenic
1047534130 8:125703833-125703855 AGTGAAGCCAAGAGCCTTCCTGG - Intergenic
1047789012 8:128183284-128183306 CCTGAAGCCCTGTGGCATGCTGG - Intergenic
1048526701 8:135209297-135209319 GGTGAAGTCCAGAGGAATTCAGG + Intergenic
1048918994 8:139210775-139210797 CAGGAAGACCAGAGGCATCACGG + Intergenic
1049250677 8:141587354-141587376 CGTGAAGCCCCATGGCATGCCGG + Intergenic
1057849067 9:98550565-98550587 TCTGAATCCCAGAGACATCCTGG + Intronic
1061072124 9:128317272-128317294 CATGCAGCCCAAAGCCATCCTGG - Intronic
1061677719 9:132227829-132227851 CTTGCAGCCCAGGGGCTTCCTGG - Intronic
1062157662 9:135062398-135062420 CTTGTAGCCAAGAGCCATCCGGG - Intergenic
1062436698 9:136549545-136549567 GCTCAAGCCCAGAGGCCTCCAGG + Intergenic
1186407466 X:9316810-9316832 CGTGAAGCCCTCCGGCTTCCAGG + Intergenic
1192554288 X:72077716-72077738 CCTCCAGCCCAGAGGGATCCGGG + Intergenic
1193546871 X:82842244-82842266 AGTGAAGCCAAGAGCCTTCCTGG - Intergenic
1200135678 X:153873495-153873517 CATGTAGCCCAGAGGCAGCCAGG + Intronic
1201158189 Y:11151044-11151066 CCAGGAGCCCAGAGGCTTCCTGG + Intergenic