ID: 1069557220

View in Genome Browser
Species Human (GRCh38)
Location 10:69406369-69406391
Sequence GAGGGGCCTGCACTTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069557220_1069557231 21 Left 1069557220 10:69406369-69406391 CCCAGAGCAAGTGCAGGCCCCTC 0: 1
1: 0
2: 1
3: 24
4: 232
Right 1069557231 10:69406413-69406435 ATCACGAGGCGTAGGGAAACTGG No data
1069557220_1069557230 14 Left 1069557220 10:69406369-69406391 CCCAGAGCAAGTGCAGGCCCCTC 0: 1
1: 0
2: 1
3: 24
4: 232
Right 1069557230 10:69406406-69406428 CCTCAGAATCACGAGGCGTAGGG No data
1069557220_1069557227 7 Left 1069557220 10:69406369-69406391 CCCAGAGCAAGTGCAGGCCCCTC 0: 1
1: 0
2: 1
3: 24
4: 232
Right 1069557227 10:69406399-69406421 CTCATTTCCTCAGAATCACGAGG No data
1069557220_1069557228 13 Left 1069557220 10:69406369-69406391 CCCAGAGCAAGTGCAGGCCCCTC 0: 1
1: 0
2: 1
3: 24
4: 232
Right 1069557228 10:69406405-69406427 TCCTCAGAATCACGAGGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069557220 Original CRISPR GAGGGGCCTGCACTTGCTCT GGG (reversed) Intronic
900184365 1:1325954-1325976 CACGGGCCCGCACCTGCTCTGGG - Intronic
900690431 1:3977474-3977496 GAGGGGCCTGGACTGGCCCCTGG + Intergenic
901931098 1:12596379-12596401 GAGGTGCCTGCCTTTGCTCTGGG + Intronic
902943024 1:19814217-19814239 GACAGGCTTGCACTTGCCCTTGG - Exonic
904300241 1:29549464-29549486 GGGGGGTCTGCACTTGATCCTGG - Intergenic
904457994 1:30658651-30658673 GGGGGGTCTGCACTTGATCCTGG + Intergenic
906157398 1:43621813-43621835 CAGGGTCCAGCACCTGCTCTTGG + Intronic
906291518 1:44622520-44622542 CAGGGGCCAGCACTAGCCCTTGG + Intronic
906560556 1:46753808-46753830 GAGGGGCCTGGACATGATTTGGG - Intergenic
907046547 1:51303329-51303351 GAGGGGCAGCCACTTGCTCAGGG - Intronic
907117609 1:51982984-51983006 GCAGGGCCGGCAGTTGCTCTGGG - Intronic
907516130 1:54994554-54994576 GAGGGGCCATGACTTGCTCAAGG + Intergenic
909881931 1:80890767-80890789 GAGGGGCCTGCTCTTCCTAGAGG - Intergenic
912591786 1:110829680-110829702 GTGGGGTCTGCACTAACTCTGGG - Intergenic
914777995 1:150755792-150755814 GAAAGGCCTGGAGTTGCTCTGGG + Intronic
915267007 1:154726220-154726242 GAGGGGTCTGCAGTGCCTCTTGG + Intronic
917733678 1:177901137-177901159 GAAGGGCCAGCCCTAGCTCTTGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918257364 1:182761467-182761489 TAGGGGCCTGCATATGCACTAGG - Intergenic
920011792 1:202873464-202873486 CAGGATGCTGCACTTGCTCTGGG - Intergenic
920774536 1:208923313-208923335 GTGGGGCCTGAAGTTGCTCCAGG - Intergenic
922241073 1:223755818-223755840 GAGGCCCCTGCAGTGGCTCTGGG + Intronic
922844173 1:228670021-228670043 GGTGGGCCTGGCCTTGCTCTTGG + Intergenic
1063430257 10:5981966-5981988 CAGGGTTCTGCACGTGCTCTAGG + Intergenic
1065965942 10:30770188-30770210 GATGGACCTGGACCTGCTCTAGG - Intergenic
1069557220 10:69406369-69406391 GAGGGGCCTGCACTTGCTCTGGG - Intronic
1070325592 10:75386823-75386845 GAGGAGGCAGCACTTGATCTGGG - Intergenic
1070688340 10:78506688-78506710 GAGAGCCCTGCAGGTGCTCTGGG - Intergenic
1070688831 10:78509800-78509822 CAGGCCCCTGCACTTGCTCCTGG - Intergenic
1072896633 10:99372810-99372832 GAGGGGCCGGGACTTTCTCACGG + Intronic
1076844231 10:133061088-133061110 GAGGGCCCTGCAGGTGCTCCAGG + Intergenic
1077340875 11:2025812-2025834 GAGGTGCCTGCGGCTGCTCTGGG - Intergenic
1078760196 11:14245523-14245545 GAGGGTTCTGCCCCTGCTCTGGG - Intronic
1083336340 11:61923936-61923958 GAGGGGCCTGGGCCTGGTCTTGG - Intergenic
1083904897 11:65662998-65663020 GCGCGGCGTGCACTTGCTCCCGG - Exonic
1084071919 11:66742412-66742434 GAGAGGCCTCCACTGCCTCTAGG + Intergenic
1085049835 11:73374686-73374708 GAGGGGCCTGGACCCTCTCTGGG + Intergenic
1085605195 11:77891339-77891361 GAGGATCCTGCACATGCTCCAGG + Exonic
1088328883 11:108629414-108629436 GCTGGGCATGCACATGCTCTGGG - Intergenic
1088918897 11:114247381-114247403 GAGGGGCCTGAGCTGGCTCTGGG + Intronic
1202823860 11_KI270721v1_random:81001-81023 GAGGTGCCTGCGGCTGCTCTGGG - Intergenic
1091403069 12:192610-192632 GAGGGGGGTGTACTTGCTCAAGG + Exonic
1091843142 12:3634491-3634513 GAGGGGAGTGAACTTGCTCTAGG + Intronic
1092530503 12:9340501-9340523 GCGTGGCCTGCAGCTGCTCTTGG - Intergenic
1094141180 12:27183192-27183214 GTGGGGTCTGCACTCACTCTGGG + Intergenic
1096804724 12:54133682-54133704 GACGGGCCTGCAGCTTCTCTGGG - Intergenic
1103027124 12:117582749-117582771 GAGGGGAAGTCACTTGCTCTAGG + Intronic
1103182509 12:118925947-118925969 GATGGGCCTGAAAGTGCTCTAGG - Intergenic
1103915959 12:124375884-124375906 GAGGGGCCTGCAGTGCCGCTGGG + Intronic
1104035862 12:125096777-125096799 GAAGGGCAGGCACTTGCTCTCGG + Intronic
1104748473 12:131224114-131224136 GGGCGGCCTGCACTGGCTCTGGG - Intergenic
1104749861 12:131231627-131231649 GAGGGGTCTGCACGTGGGCTGGG - Intergenic
1104880089 12:132064760-132064782 GCGAGGTCTGCACTTGCACTTGG - Exonic
1104932348 12:132346312-132346334 CAGGGGCCTTCACCTGCTCTCGG + Intergenic
1105894223 13:24704774-24704796 AAAGGGACTGCACTTCCTCTTGG + Intronic
1106219026 13:27729437-27729459 GAGCTGCCTGCCCATGCTCTTGG + Intergenic
1112328069 13:98457112-98457134 GAGAGACCTGCACTTGGGCTGGG - Intronic
1117521559 14:56556731-56556753 GAAGCCCCTGCACTTGATCTTGG + Intronic
1121348639 14:93155081-93155103 GAGGGGCCTACACTTGTCCTTGG + Intergenic
1122021120 14:98838851-98838873 GAGGGGCCCACCCTTGCTCTTGG - Intergenic
1122143609 14:99676255-99676277 GAGGAGCCAGCACCTGCTCAGGG + Exonic
1122152745 14:99733505-99733527 CAGGGGCCTGAACAAGCTCTGGG - Intergenic
1122663650 14:103314472-103314494 GAGAGCCCAGCTCTTGCTCTCGG + Intergenic
1122695083 14:103548542-103548564 GAGGGGCATGCCCTTGCTGATGG - Intergenic
1122856482 14:104562684-104562706 GAGGTGGCTGGACTTGCTCATGG + Intronic
1122965480 14:105122415-105122437 GACAGGACTGCACTTGCTCAAGG - Intergenic
1124929096 15:34101676-34101698 GAGGGGCGTGCAGTTGTTCCAGG - Exonic
1125493632 15:40168723-40168745 CAGGGGTCTCCATTTGCTCTCGG + Intronic
1125518545 15:40336057-40336079 GAGGGGCCTCCACCTCCTCTGGG + Intronic
1127353401 15:58174577-58174599 GTGGGGCTTGGTCTTGCTCTAGG - Intronic
1129687626 15:77695649-77695671 GAGGGGCCAGCTCTGGCCCTGGG + Intronic
1130051236 15:80485704-80485726 CAGTGGCCTGCAATTGGTCTTGG - Intronic
1130561935 15:84965645-84965667 GAGGGCCATGCACTTCTTCTAGG + Intergenic
1131524630 15:93143160-93143182 GAGGGGCCTGCGTTTCCTCCAGG - Intergenic
1131547983 15:93331994-93332016 GAGGGGCCTGCAGGAGATCTGGG - Intergenic
1132649502 16:1014158-1014180 GAGGGGCCTGGAATTCCTCCAGG + Intergenic
1132683205 16:1152305-1152327 AAGGGGCCTGCACTTCTCCTCGG + Intergenic
1132907700 16:2291596-2291618 GAGGGGCCTGCACTGCCTTGGGG - Intronic
1133140841 16:3742885-3742907 GAGGGGGCTGGACCTGCTCTGGG + Intronic
1133191809 16:4139447-4139469 GAGGAGCCAACACTTGGTCTTGG - Intergenic
1138595578 16:58027397-58027419 GTGGACCCTGCTCTTGCTCTGGG - Intronic
1138652587 16:58469394-58469416 GAGGGGCGTGCTGTTCCTCTGGG + Intronic
1139422081 16:66855072-66855094 GTGGAGCCTTCACTTGCTCTGGG + Intronic
1140598930 16:76451069-76451091 GATGGGCCTGGGCTTGCTGTCGG + Intronic
1141643496 16:85355144-85355166 GTGGGGCCTGCGCTTGCCCGAGG + Intergenic
1142232453 16:88906182-88906204 GAGGAGCCTGCAGTTGGCCTTGG - Intronic
1142979076 17:3661230-3661252 AAGGGGCCTGCCCTCGCTCCAGG - Exonic
1143386955 17:6536650-6536672 GCGGGGCTTTCACTTTCTCTGGG - Intronic
1144260095 17:13510131-13510153 GAGGGGCCTGCCCTTGGCCCAGG - Intronic
1144558611 17:16303329-16303351 CAGGGGCCTGCTCTAGTTCTTGG - Intronic
1145997257 17:29111812-29111834 GAGGGGCCTGCTCTGGCTATTGG - Exonic
1147896587 17:43755474-43755496 GAGGCGCTTGCACTTGCACGAGG + Exonic
1149597857 17:57874708-57874730 GTGGGGGCTGCTCTAGCTCTCGG + Intronic
1149641327 17:58204804-58204826 CAGCAGCCTGCACTTGCTCCAGG - Exonic
1150213321 17:63453470-63453492 GAGGGCCCTGCCCCTGCTCCAGG - Intergenic
1151327473 17:73388088-73388110 GAGGGGGCTGGACTTTCTCGAGG + Intronic
1151498801 17:74475675-74475697 GTGGGGTCTGCACTAACTCTGGG - Intronic
1152501284 17:80711173-80711195 GAGGTGCCTTCCTTTGCTCTTGG + Intronic
1152567790 17:81107899-81107921 GAGGGGTCTGCATCTGCCCTAGG + Intronic
1152620927 17:81364505-81364527 GAGGGGCCTGGACCTGCACGGGG + Intergenic
1203171174 17_GL000205v2_random:148877-148899 GTGAGGCCTCCACCTGCTCTGGG + Intergenic
1154055923 18:11014105-11014127 GAGGCACCTCCACTTGCTGTAGG + Intronic
1157300595 18:46476333-46476355 GAGGGGCCTGAACTTGCCTCAGG + Intergenic
1159587858 18:70299174-70299196 GTGGGGACTGTACTTACTCTGGG - Intronic
1160474934 18:79174511-79174533 GAGGGCCCTTCTCTTGCGCTTGG + Intronic
1161558386 19:4957193-4957215 CTGGGGCCTGCAGTGGCTCTGGG + Intronic
1161577402 19:5062036-5062058 ATGGGGCCTGCACCTGCTCTGGG + Intronic
1161582114 19:5086723-5086745 GAGGGAGCTGCACTGGCTCGAGG - Intronic
1162936398 19:13983692-13983714 GAGGGGCCTGACCTTGCTGGGGG - Intronic
1163488649 19:17604655-17604677 GCGTGGACTACACTTGCTCTGGG - Exonic
1165890116 19:39106900-39106922 GCGGGTCCTCCACCTGCTCTGGG + Intronic
1167591957 19:50409021-50409043 GAGGGGCCTGCGTGTGCTCATGG + Intronic
1168057008 19:53869553-53869575 GCGGGGCGTGCACTTTCGCTGGG + Exonic
925154873 2:1641052-1641074 GTGGGGTCTGCACTAGGTCTGGG - Intronic
926061429 2:9807412-9807434 GACGGGGCTGCACTCGCTCCAGG - Intergenic
926425460 2:12735331-12735353 CAGGAGCCTGCTCTTTCTCTAGG - Intronic
928624881 2:33129336-33129358 GAGGCGACAGCACTTGCTGTCGG + Intronic
931712098 2:64997090-64997112 GAGGGCACTGCTCCTGCTCTTGG + Intronic
932720768 2:74137788-74137810 GAGGGCCCTGCACTTGATTGTGG - Intronic
933986182 2:87594107-87594129 AAGGGGCTTCCACTGGCTCTTGG + Intergenic
934780371 2:96966101-96966123 CAGGGGCAGGCACTGGCTCTTGG - Intronic
936307653 2:111356696-111356718 AAGGGGCTTCCACTGGCTCTTGG - Intergenic
936924331 2:117721314-117721336 GAGGGGCCTGCATTTGGGATTGG + Intergenic
937292216 2:120788576-120788598 GAGGGGCCTGCATTTCCCATTGG + Intronic
937839964 2:126515001-126515023 GTGGGGTCTGCACTAACTCTGGG - Intergenic
937888720 2:126918682-126918704 GAGGGGACTGCACTAACTCCAGG - Intergenic
940035552 2:149309212-149309234 GAGGGGTCTGCACTAACTCCAGG - Intergenic
940639806 2:156333868-156333890 GAGGGGCCCGAGCTGGCTCTGGG + Intronic
940817621 2:158313321-158313343 GGGAGGCCAGCACTTGCCCTGGG - Intronic
946153099 2:217789492-217789514 GAGGGGCCTAAACTTGGACTGGG - Intergenic
947633385 2:231667532-231667554 ATGGTCCCTGCACTTGCTCTCGG + Intergenic
1170706737 20:18750354-18750376 GAGGGGGCTGCTGTTGTTCTGGG - Intronic
1170873920 20:20233425-20233447 GACGGCCCTGCACATGCCCTGGG - Intronic
1172939654 20:38645757-38645779 GAGGGTCCTGCACCTGCTGAGGG - Intronic
1173998725 20:47358904-47358926 GAGGGGCCTGCTCTTCCTGGAGG + Intergenic
1174160184 20:48545097-48545119 GATGGGCCAGCACCTGCTCTGGG - Intergenic
1175155950 20:56971708-56971730 GAGGGTCCTGGACTGGCTCCAGG - Intergenic
1175838556 20:62012091-62012113 GAGGGGCCAGCACCTGCTCTGGG + Intronic
1176066203 20:63197315-63197337 GAGGGGCATGCTCTTCCCCTTGG - Intronic
1176327158 21:5510707-5510729 GTGAGGCCTCCACCTGCTCTGGG + Intergenic
1176400599 21:6310244-6310266 GTGAGGCCTCCACCTGCTCTGGG - Intergenic
1176436558 21:6678860-6678882 GTGAGGCCTCCACCTGCTCTGGG + Intergenic
1176460820 21:7005930-7005952 GTGAGGCCTCCACCTGCTCTGGG + Intergenic
1176484381 21:7387708-7387730 GTGAGGCCTCCACCTGCTCTGGG + Intergenic
1179178122 21:39023240-39023262 GAGGGGCCTGCCTTTTCGCTGGG - Intergenic
1179611643 21:42555899-42555921 GGCGGGCCTGCCATTGCTCTTGG + Intronic
1179928239 21:44550288-44550310 GTGGGGCCTGGCCTGGCTCTGGG - Intronic
1179939446 21:44628425-44628447 GTGGGGCCTGGCCTGGCTCTGGG + Intronic
1180058753 21:45374200-45374222 GAGGGGCCGGCGCCTGCACTGGG - Intergenic
1180856122 22:19046769-19046791 GAGAGGGCTGCAGCTGCTCTGGG + Intronic
1182041570 22:27242317-27242339 GAGGGGCCGGCACTTGTTTAGGG - Intergenic
1182270796 22:29152142-29152164 CAGGGGACTGCCCTTGCTCCTGG - Intronic
1182666450 22:31963837-31963859 GAGAGGCCAGGACTTGCTCAAGG - Intergenic
1183617473 22:38954384-38954406 GAGGTGGCTGCACCTGCCCTTGG - Intronic
1184412545 22:44333257-44333279 GAGGGTGCAGCACTTGCCCTCGG - Intergenic
1185057849 22:48590298-48590320 GCGGTGCGTGCCCTTGCTCTGGG - Intronic
1185072692 22:48666006-48666028 GAGGGGCCTGGCCTGGCTCCAGG + Intronic
1185154056 22:49182733-49182755 GTGGGGCCTGGACTTGCACATGG - Intergenic
949185982 3:1191753-1191775 GTGGGGGCTACACTTACTCTAGG + Intronic
949742479 3:7252382-7252404 GAGTGGTCTGCACATGGTCTGGG + Intronic
950012124 3:9731392-9731414 GAGGGACCTGGCCTTGGTCTCGG - Intergenic
950140753 3:10613485-10613507 GTGGGGTCTGCATTAGCTCTGGG + Intronic
951444326 3:22760565-22760587 GAGGGCCCAGAAGTTGCTCTGGG - Intergenic
952841632 3:37651683-37651705 GATGGGCCTGAACTTGCCCAGGG + Intronic
952955378 3:38554035-38554057 GAGGACCCAGCACTTGCTCCTGG - Intronic
953062202 3:39436212-39436234 GATGGGCCTGCTCTTGGTGTAGG - Intergenic
954240879 3:49292523-49292545 CAGGGGCCTGCAATGGCTCCAGG - Exonic
954272937 3:49523681-49523703 GAGGAGCCTGGACATGCCCTGGG + Intronic
954388699 3:50257943-50257965 GAAGGGCCTGGCCTTGCCCTGGG + Intronic
954813223 3:53260598-53260620 GAGGGGGCTGCACTTGGGCCGGG + Intergenic
956738254 3:72255608-72255630 GAAGAGGCTGCACTTTCTCTGGG - Intergenic
956755414 3:72381136-72381158 AAGGGGCATGTACTTACTCTAGG + Intronic
959177767 3:102938037-102938059 GGGTGGCGTCCACTTGCTCTTGG + Intergenic
961407564 3:126692455-126692477 GTGGGGCCTGCACTGACTCCAGG + Intergenic
961603565 3:128077696-128077718 GAGGGGCCAGCACTGGCTCAGGG - Intronic
962623621 3:137203092-137203114 CAGGGGCCTCCCCTTACTCTTGG + Intergenic
964609430 3:158595401-158595423 GATGTATCTGCACTTGCTCTGGG - Intronic
967483975 3:190008785-190008807 GAGGGGCCTGTACTGGCCATTGG + Intronic
968920822 4:3521419-3521441 GCGGGGCCTCCACATGCTCTGGG + Intronic
972245533 4:37243289-37243311 TCTGGGCCTGCACTTCCTCTGGG - Intergenic
972287218 4:37660703-37660725 CAGGGTACTGCACTTGCTCAAGG + Intronic
979610873 4:122687508-122687530 TTGGGGCCTGCCCTAGCTCTGGG + Intergenic
981295445 4:143125972-143125994 GTGGGGTCTGCACTAACTCTGGG - Intergenic
981785804 4:148478440-148478462 GAGGGGTCTGCCCTTGCTGGTGG - Intergenic
981824727 4:148926884-148926906 GATGGGCCTGCACAAACTCTTGG + Intergenic
981905166 4:149914401-149914423 GAGCAGCCTGCAATTGCTCTGGG - Intergenic
982016612 4:151160865-151160887 GAGAGGCGTGCAGTGGCTCTGGG + Intronic
985174304 4:187185222-187185244 AAGGAGCCAGGACTTGCTCTAGG + Intergenic
985637956 5:1049116-1049138 GCGGGTCCTGCTCTGGCTCTCGG - Intergenic
985894660 5:2741050-2741072 GCGGGACCCGCACTCGCTCTGGG + Intergenic
985916031 5:2919821-2919843 GAGGGGCTCCCACCTGCTCTCGG - Intergenic
985924222 5:3003249-3003271 GAGAGGCATGCATTTGCTCTTGG + Intergenic
988968411 5:36442415-36442437 TAAGGGCCTGCACGTGCACTAGG - Intergenic
990005139 5:50937211-50937233 TAGAGGCCTGCCCTTGATCTTGG - Intergenic
991621104 5:68546060-68546082 GAGGGCCCTCAACTTGTTCTTGG - Intergenic
995324121 5:110872400-110872422 GAGCGCCTTGCACTTGCCCTGGG - Intergenic
997210871 5:132075966-132075988 GAGTGGCCTGGACCTGCCCTGGG + Exonic
997233937 5:132261822-132261844 GATGGCCCTGGACTTGCTCAGGG + Intronic
997257057 5:132437168-132437190 CAGGGGCCTGCTCTGTCTCTGGG - Intronic
999267331 5:150275452-150275474 GTGGGGTCTGCACTAACTCTAGG - Intronic
1000772515 5:165373184-165373206 GAGGGGACTGCAAATGCTCATGG + Intergenic
1002643137 5:180640107-180640129 GAGGGTCCTGCACCTCCCCTGGG + Intronic
1002761227 6:203919-203941 GAGGGGCCTGGAATTGCTGGTGG - Intergenic
1004440124 6:15642007-15642029 CAGGGGCCAGCACATGCACTCGG + Intronic
1006804252 6:36778140-36778162 GAGGGGTCTTCACTTGCCCAGGG + Intronic
1012002288 6:93667895-93667917 GTGTAGCCTTCACTTGCTCTGGG - Intergenic
1013709050 6:112875608-112875630 GAGGGGTCTGCACTAATTCTGGG + Intergenic
1015747873 6:136529788-136529810 GTGGGGCCTGCAGTTGCTCGGGG - Intronic
1016614249 6:146028491-146028513 GGGGGTCCTGCGCTTGCTTTGGG - Intronic
1019019191 6:168903090-168903112 TAGGGGCCAGCACCTGCTCCTGG + Intergenic
1019047412 6:169159671-169159693 GAGGAGCCTCCAGTTGCACTTGG + Intergenic
1019363509 7:618051-618073 GAGGAGCCTGCACTGGTCCTGGG - Intronic
1019395567 7:816284-816306 GAGGGGTCTGCACCTGCTGGGGG - Intergenic
1019538392 7:1540473-1540495 GAGGGGCCTGCGCTTGGACTCGG - Exonic
1019571162 7:1713077-1713099 GAGGAGCCTGAACTTGGGCTGGG - Intronic
1020094940 7:5362896-5362918 CTGGGGCCTGCGCTTGCTTTGGG - Intronic
1022782218 7:33597724-33597746 GGGGAACCTGCACTAGCTCTGGG + Intronic
1023760031 7:43456714-43456736 GAGGGGCATACACTGGCCCTTGG - Intronic
1025847407 7:65212752-65212774 GAGGATCCTGCACATGCTCCAGG - Intergenic
1025897651 7:65718642-65718664 GAGGATCCTGCACATGCTCCAGG - Intergenic
1026448343 7:70505492-70505514 AAAGGGCCTGCACTTTCTCCTGG + Intronic
1029483324 7:100825454-100825476 AGGGAGCCTGCGCTTGCTCTGGG - Intronic
1029726300 7:102407825-102407847 GAGGTGCCTGCAGCAGCTCTCGG + Intronic
1029941452 7:104484707-104484729 GAAGGGCCTGCACCTGGTCAGGG + Intronic
1030007781 7:105135463-105135485 GTGGGGGCGGAACTTGCTCTTGG - Intronic
1032625764 7:133590145-133590167 CAGGGGCCTGCATGTGCACTGGG - Intronic
1033436109 7:141335012-141335034 GAGGGGCCTGCAGTTTCTCCTGG + Intronic
1034348462 7:150401392-150401414 GAGGGGCCTGCCCTCTCCCTCGG - Intronic
1037492139 8:19406757-19406779 GAGGGGCTTGCAGTGCCTCTCGG + Intronic
1038193102 8:25341982-25342004 GAGAGGTTTGCACTTTCTCTGGG + Intronic
1038530773 8:28316738-28316760 GAGGTGGCTGCACCTGCCCTGGG - Intergenic
1038531688 8:28323006-28323028 GAGGGGACTGCTCTTGCTAGAGG - Intronic
1040081732 8:43292248-43292270 GTGGGGCGTGCACTTTCCCTGGG + Intergenic
1041661042 8:60401450-60401472 GAGGGGCCTGCACATGCTTCAGG + Intergenic
1042862649 8:73329677-73329699 GTGGGGCCTGCACTAACTCTGGG - Intergenic
1048564593 8:135581996-135582018 GGGGGGACTCCTCTTGCTCTGGG - Exonic
1048994378 8:139783991-139784013 GAGGTGCCTCCACTTGATCAAGG + Intronic
1049317160 8:141975444-141975466 AGGGGGCCTGCACCTGCTCCTGG - Intergenic
1049472488 8:142782693-142782715 GAGGGGCCTGCGAGTGCTCCTGG - Intergenic
1055225021 9:73985051-73985073 GAGAGGCTTTCAGTTGCTCTTGG - Intergenic
1059434401 9:114267456-114267478 CAGGGGGCAGCTCTTGCTCTAGG + Intronic
1061211391 9:129195423-129195445 GAGGGGGGGGCACTTGCTCAGGG + Intergenic
1062294079 9:135814502-135814524 GAGGGTCCTGCACGGGGTCTAGG - Intronic
1062569516 9:137178695-137178717 GTGTGGCTTGCACCTGCTCTCGG - Intronic
1188443968 X:30237736-30237758 GAGGGACCTGCACTTTCCTTAGG - Intergenic
1189478250 X:41373857-41373879 GAGGGGCCTGAACTTGGCCTGGG - Intergenic
1190656550 X:52617818-52617840 GATGAGTCTGCACTTTCTCTAGG - Intergenic
1191608274 X:63084600-63084622 GAGAGGCCTGAAGTTGCTTTTGG - Intergenic
1191638521 X:63404351-63404373 GAAGGGCCTGCATATGCACTGGG - Intergenic
1193613477 X:83659852-83659874 GAGGGGCCTGCTCTTCCTTGTGG - Intergenic
1193714910 X:84926834-84926856 GAGAGGCCTTCAGTTGCTCCTGG + Intergenic
1193749778 X:85327190-85327212 GAGCAACCTGCACTTGCCCTGGG - Intronic
1194740496 X:97567547-97567569 AAGGGGACTTCACTTGATCTTGG + Intronic
1195038238 X:100989851-100989873 GAGGGGCTTGGACTTGGCCTGGG + Intronic
1195218338 X:102722079-102722101 GAGAGGTCTGCACTAACTCTGGG - Intronic
1195736340 X:108016677-108016699 GAGGAGGCTGCATTTGGTCTGGG + Intergenic
1198338396 X:135690315-135690337 GAGGGGCAGGAACTTGGTCTTGG + Intergenic
1198814919 X:140579784-140579806 AAGGGGCCAGCACTTGCACGAGG - Intergenic