ID: 1069562512

View in Genome Browser
Species Human (GRCh38)
Location 10:69440822-69440844
Sequence AAAGATGCGCAGTTGCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069562507_1069562512 -1 Left 1069562507 10:69440800-69440822 CCCGAAAAATGAACAAGTCCCAA No data
Right 1069562512 10:69440822-69440844 AAAGATGCGCAGTTGCACCTGGG No data
1069562508_1069562512 -2 Left 1069562508 10:69440801-69440823 CCGAAAAATGAACAAGTCCCAAA No data
Right 1069562512 10:69440822-69440844 AAAGATGCGCAGTTGCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069562512 Original CRISPR AAAGATGCGCAGTTGCACCT GGG Intergenic
No off target data available for this crispr