ID: 1069564478

View in Genome Browser
Species Human (GRCh38)
Location 10:69454079-69454101
Sequence TGGTGCCATCTCTGGGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069564472_1069564478 0 Left 1069564472 10:69454056-69454078 CCTATTATCTCTGGTGCCATCTC 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1069564478 10:69454079-69454101 TGGTGCCATCTCTGGGGTTGAGG No data
1069564470_1069564478 15 Left 1069564470 10:69454041-69454063 CCATTTACAGGAAAGCCTATTAT 0: 1
1: 0
2: 0
3: 19
4: 241
Right 1069564478 10:69454079-69454101 TGGTGCCATCTCTGGGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069564478 Original CRISPR TGGTGCCATCTCTGGGGTTG AGG Intronic
No off target data available for this crispr