ID: 1069568592

View in Genome Browser
Species Human (GRCh38)
Location 10:69480184-69480206
Sequence GTGGCAGCTCTGGTGTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069568582_1069568592 23 Left 1069568582 10:69480138-69480160 CCTTTATGGAGAGGGCTGGGGTC 0: 1
1: 0
2: 0
3: 17
4: 153
Right 1069568592 10:69480184-69480206 GTGGCAGCTCTGGTGTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069568592 Original CRISPR GTGGCAGCTCTGGTGTTTGG GGG Intronic
No off target data available for this crispr