ID: 1069569769

View in Genome Browser
Species Human (GRCh38)
Location 10:69487240-69487262
Sequence GCCACTTGCCCCTGTATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069569769_1069569772 -1 Left 1069569769 10:69487240-69487262 CCACTCATACAGGGGCAAGTGGC No data
Right 1069569772 10:69487262-69487284 CCATCCTATCAATGGAGTCATGG No data
1069569769_1069569770 -9 Left 1069569769 10:69487240-69487262 CCACTCATACAGGGGCAAGTGGC No data
Right 1069569770 10:69487254-69487276 GCAAGTGGCCATCCTATCAATGG No data
1069569769_1069569775 10 Left 1069569769 10:69487240-69487262 CCACTCATACAGGGGCAAGTGGC No data
Right 1069569775 10:69487273-69487295 ATGGAGTCATGGAGGCACACAGG No data
1069569769_1069569773 2 Left 1069569769 10:69487240-69487262 CCACTCATACAGGGGCAAGTGGC No data
Right 1069569773 10:69487265-69487287 TCCTATCAATGGAGTCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069569769 Original CRISPR GCCACTTGCCCCTGTATGAG TGG (reversed) Intronic