ID: 1069569773

View in Genome Browser
Species Human (GRCh38)
Location 10:69487265-69487287
Sequence TCCTATCAATGGAGTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069569769_1069569773 2 Left 1069569769 10:69487240-69487262 CCACTCATACAGGGGCAAGTGGC No data
Right 1069569773 10:69487265-69487287 TCCTATCAATGGAGTCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069569773 Original CRISPR TCCTATCAATGGAGTCATGG AGG Intronic