ID: 1069570559

View in Genome Browser
Species Human (GRCh38)
Location 10:69492177-69492199
Sequence CACTGGGTATGTTGGGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069570540_1069570559 25 Left 1069570540 10:69492129-69492151 CCCTGCTGGCATGGCCTGGTTTG 0: 1
1: 1
2: 2
3: 15
4: 210
Right 1069570559 10:69492177-69492199 CACTGGGTATGTTGGGCATCTGG No data
1069570539_1069570559 26 Left 1069570539 10:69492128-69492150 CCCCTGCTGGCATGGCCTGGTTT 0: 1
1: 0
2: 0
3: 19
4: 168
Right 1069570559 10:69492177-69492199 CACTGGGTATGTTGGGCATCTGG No data
1069570541_1069570559 24 Left 1069570541 10:69492130-69492152 CCTGCTGGCATGGCCTGGTTTGG 0: 1
1: 1
2: 1
3: 18
4: 188
Right 1069570559 10:69492177-69492199 CACTGGGTATGTTGGGCATCTGG No data
1069570549_1069570559 11 Left 1069570549 10:69492143-69492165 CCTGGTTTGGAGGGGAATGGGGT 0: 1
1: 0
2: 0
3: 27
4: 334
Right 1069570559 10:69492177-69492199 CACTGGGTATGTTGGGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069570559 Original CRISPR CACTGGGTATGTTGGGCATC TGG Intronic
No off target data available for this crispr