ID: 1069577813

View in Genome Browser
Species Human (GRCh38)
Location 10:69543401-69543423
Sequence CATCCCTCCAAATGTCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069577813_1069577817 26 Left 1069577813 10:69543401-69543423 CCCAAAGGACATTTGGAGGGATG No data
Right 1069577817 10:69543450-69543472 CTATTTGTTGAGATAAGGTGTGG No data
1069577813_1069577816 21 Left 1069577813 10:69543401-69543423 CCCAAAGGACATTTGGAGGGATG No data
Right 1069577816 10:69543445-69543467 ACTGTCTATTTGTTGAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069577813 Original CRISPR CATCCCTCCAAATGTCCTTT GGG (reversed) Intergenic
No off target data available for this crispr