ID: 1069583319

View in Genome Browser
Species Human (GRCh38)
Location 10:69579652-69579674
Sequence AAGTTCGCACAGATGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069583319_1069583325 5 Left 1069583319 10:69579652-69579674 CCACCCACCATCTGTGCGAACTT No data
Right 1069583325 10:69579680-69579702 CTCTTCTCATTCCCTAAATAGGG No data
1069583319_1069583326 6 Left 1069583319 10:69579652-69579674 CCACCCACCATCTGTGCGAACTT No data
Right 1069583326 10:69579681-69579703 TCTTCTCATTCCCTAAATAGGGG No data
1069583319_1069583324 4 Left 1069583319 10:69579652-69579674 CCACCCACCATCTGTGCGAACTT No data
Right 1069583324 10:69579679-69579701 GCTCTTCTCATTCCCTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069583319 Original CRISPR AAGTTCGCACAGATGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr