ID: 1069583951

View in Genome Browser
Species Human (GRCh38)
Location 10:69584575-69584597
Sequence CAATGGGAATGGAGTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069583940_1069583951 15 Left 1069583940 10:69584537-69584559 CCCAGGTGAGAGAGGATGGGGCC No data
Right 1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG No data
1069583945_1069583951 -6 Left 1069583945 10:69584558-69584580 CCTGACCAGGGTAAGGACAATGG No data
Right 1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG No data
1069583941_1069583951 14 Left 1069583941 10:69584538-69584560 CCAGGTGAGAGAGGATGGGGCCT No data
Right 1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069583951 Original CRISPR CAATGGGAATGGAGTGAAGT GGG Intergenic
No off target data available for this crispr