ID: 1069586110

View in Genome Browser
Species Human (GRCh38)
Location 10:69603728-69603750
Sequence GTTGCAAATAAACCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069586106_1069586110 29 Left 1069586106 10:69603676-69603698 CCCTAATCCAGTACTATCTTATC No data
Right 1069586110 10:69603728-69603750 GTTGCAAATAAACCACAAGCTGG No data
1069586108_1069586110 22 Left 1069586108 10:69603683-69603705 CCAGTACTATCTTATCTGAACTA No data
Right 1069586110 10:69603728-69603750 GTTGCAAATAAACCACAAGCTGG No data
1069586107_1069586110 28 Left 1069586107 10:69603677-69603699 CCTAATCCAGTACTATCTTATCT No data
Right 1069586110 10:69603728-69603750 GTTGCAAATAAACCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069586110 Original CRISPR GTTGCAAATAAACCACAAGC TGG Intergenic
No off target data available for this crispr