ID: 1069590116

View in Genome Browser
Species Human (GRCh38)
Location 10:69636193-69636215
Sequence CCCTGAAAGGCTCTGAGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069590116_1069590124 2 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590124 10:69636218-69636240 TCACTGAAAGCATGGTGGGTAGG No data
1069590116_1069590122 -3 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590122 10:69636213-69636235 GGGGATCACTGAAAGCATGGTGG No data
1069590116_1069590130 22 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590130 10:69636238-69636260 AGGAGGTGGGCAGAGGGCCGTGG No data
1069590116_1069590125 5 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590125 10:69636221-69636243 CTGAAAGCATGGTGGGTAGGAGG No data
1069590116_1069590131 27 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590131 10:69636243-69636265 GTGGGCAGAGGGCCGTGGAGAGG No data
1069590116_1069590123 -2 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590123 10:69636214-69636236 GGGATCACTGAAAGCATGGTGGG No data
1069590116_1069590129 16 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590129 10:69636232-69636254 GTGGGTAGGAGGTGGGCAGAGGG No data
1069590116_1069590134 30 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590134 10:69636246-69636268 GGCAGAGGGCCGTGGAGAGGGGG No data
1069590116_1069590128 15 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590128 10:69636231-69636253 GGTGGGTAGGAGGTGGGCAGAGG No data
1069590116_1069590126 8 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590126 10:69636224-69636246 AAAGCATGGTGGGTAGGAGGTGG No data
1069590116_1069590121 -6 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590121 10:69636210-69636232 TCAGGGGATCACTGAAAGCATGG No data
1069590116_1069590127 9 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590127 10:69636225-69636247 AAGCATGGTGGGTAGGAGGTGGG No data
1069590116_1069590132 28 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590132 10:69636244-69636266 TGGGCAGAGGGCCGTGGAGAGGG No data
1069590116_1069590133 29 Left 1069590116 10:69636193-69636215 CCGCCTCTCAGAGCCTTTCAGGG No data
Right 1069590133 10:69636245-69636267 GGGCAGAGGGCCGTGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069590116 Original CRISPR CCCTGAAAGGCTCTGAGAGG CGG (reversed) Intergenic
No off target data available for this crispr