ID: 1069590813

View in Genome Browser
Species Human (GRCh38)
Location 10:69640796-69640818
Sequence AAACCCTGCTCCCCGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069590813_1069590818 0 Left 1069590813 10:69640796-69640818 CCTGTCCCCGGGGAGCAGGGTTT No data
Right 1069590818 10:69640819-69640841 GTGGCTCCTTCCCTCTCACATGG No data
1069590813_1069590823 19 Left 1069590813 10:69640796-69640818 CCTGTCCCCGGGGAGCAGGGTTT No data
Right 1069590823 10:69640838-69640860 ATGGCAGACTGAGTTTCTGAGGG No data
1069590813_1069590825 24 Left 1069590813 10:69640796-69640818 CCTGTCCCCGGGGAGCAGGGTTT No data
Right 1069590825 10:69640843-69640865 AGACTGAGTTTCTGAGGGCAGGG No data
1069590813_1069590822 18 Left 1069590813 10:69640796-69640818 CCTGTCCCCGGGGAGCAGGGTTT No data
Right 1069590822 10:69640837-69640859 CATGGCAGACTGAGTTTCTGAGG No data
1069590813_1069590824 23 Left 1069590813 10:69640796-69640818 CCTGTCCCCGGGGAGCAGGGTTT No data
Right 1069590824 10:69640842-69640864 CAGACTGAGTTTCTGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069590813 Original CRISPR AAACCCTGCTCCCCGGGGAC AGG (reversed) Intergenic
No off target data available for this crispr