ID: 1069591477

View in Genome Browser
Species Human (GRCh38)
Location 10:69644852-69644874
Sequence GCCCGGGCATGCTTGTGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069591468_1069591477 11 Left 1069591468 10:69644818-69644840 CCAGCTTTGGAGCTCAGCTTCCA No data
Right 1069591477 10:69644852-69644874 GCCCGGGCATGCTTGTGCGTGGG No data
1069591471_1069591477 -9 Left 1069591471 10:69644838-69644860 CCAATCACCCTCCCGCCCGGGCA No data
Right 1069591477 10:69644852-69644874 GCCCGGGCATGCTTGTGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069591477 Original CRISPR GCCCGGGCATGCTTGTGCGT GGG Intergenic