ID: 1069591596

View in Genome Browser
Species Human (GRCh38)
Location 10:69645367-69645389
Sequence CCTCATCTGCAGAGGCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069591578_1069591596 29 Left 1069591578 10:69645315-69645337 CCTCGTCCCAGTTCCTCCAGGGA No data
Right 1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG No data
1069591582_1069591596 16 Left 1069591582 10:69645328-69645350 CCTCCAGGGACCCTGCAGGTCTA No data
Right 1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG No data
1069591580_1069591596 22 Left 1069591580 10:69645322-69645344 CCAGTTCCTCCAGGGACCCTGCA No data
Right 1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG No data
1069591588_1069591596 -10 Left 1069591588 10:69645354-69645376 CCCACCCCCAGCACCTCATCTGC No data
Right 1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG No data
1069591583_1069591596 13 Left 1069591583 10:69645331-69645353 CCAGGGACCCTGCAGGTCTAGCC No data
Right 1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG No data
1069591579_1069591596 23 Left 1069591579 10:69645321-69645343 CCCAGTTCCTCCAGGGACCCTGC No data
Right 1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG No data
1069591585_1069591596 5 Left 1069591585 10:69645339-69645361 CCTGCAGGTCTAGCCCCCACCCC No data
Right 1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG No data
1069591584_1069591596 6 Left 1069591584 10:69645338-69645360 CCCTGCAGGTCTAGCCCCCACCC No data
Right 1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG No data
1069591587_1069591596 -9 Left 1069591587 10:69645353-69645375 CCCCACCCCCAGCACCTCATCTG No data
Right 1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG No data
1069591586_1069591596 -8 Left 1069591586 10:69645352-69645374 CCCCCACCCCCAGCACCTCATCT No data
Right 1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069591596 Original CRISPR CCTCATCTGCAGAGGCAAAC AGG Intergenic
No off target data available for this crispr